Yeast artificial chromosomes

From OpenWetWare
Revision as of 20:19, 1 September 2006 by Tk (talk | contribs)
Jump to navigationJump to search

Yeast artificial chromosomes (YACs) are synthetic double stranded linear constructs containing the elements necessary for replication as independent chromosomes in yeast. These elements are:

  • an autonomous replication sequence (ARS): ARS1, chromosome III ARS, ARSH4
  • a centromere: CEN4, CEN6: centromeres consist of three centromere determining elements, CDE I, CDE II, and CDE III.
  • a telomeric sequence at each end

Typically the chromosome also contains a selection marker such as TRP1, Lys2 or Ura3.

Minimal size for a YAC is between 50kb and 100kb, while maximum sizes are 1Mb to 3Mb.

A common tool for constructing YACs is a shuttle plasmid such as pYAC4 which replicates in E. coli, has a multiple cloning site, and a pair of telomeres which can be cleaved to form a linear fragment. Available as an E.coli plasmid ATCC 67379, sequence at U01086.

There are two common centromere sequences, CEN4 and CEN6. CEN4 is found in most yeast centromere-containiing vectors, such as pYAC4. These vectors typically use ARS1 sequences.

The pRS313- pRS316 plasmids use the CEN6 + ARSH4 cassette (Sikorski89).

Yeast strains

  • AB1380 (MATa ura3-52 trp1 lys2-1 ade2-1 can1-100 his5) (Burke87) ATCC 204682
  • J57D (MATa, ura3-52, trp1 ade2-101 can1-100 leu2-3, 112 his3-6) (Haldi96)
    • claimed to be 2-3x more efficient at large insert cloning than AB1380
  • W303-1a (MATa leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15 ybp1-1) Rothstein notes (see Veal03) Open Biosystems: YSC1058
  • YPH500 (MATα ura3-52 lys2-801_amber ade2-101_ochre trp1-Δ63 his1-Δ200 leu2-Δ1) ATCC:204680 (Sikorski89)
  • S288C (MATα SUC2 gal2 mal mel flo1 flo8-1 hap1) ATCC: 204508 (Mortimer86)


YAC Plasmids

  • pYAC4 (Burke87) has Sup4 for ade2 selection, interrupted by the cloning site (EcoRI), ura3, a pair of facing telomeres surrounding a his3 gene (linearized and cut out with BamHI), a pBR322 based E. coli replication and ampR region, a barely functional TRP1 gene, ARS1 and CEN4. Sequence at Genbank U01086
  • pJS97 / pJS98 plasmids (Shero91) are available at ATCC 77191 as a two-plasmid kit. Each plasmid supplies one chromosome end.
    • pJS97 has CEN4 and ARSH4, URA3 gene, Sup11 tRNA for ade2 selection, a pUC19 derived E. coli replication region, including ampR, and a telomere.
    • pJS98 has ARSH4, a functional TRP1 gene, a pUC19 derived E. coli replication region including ampR, and a telomere.
  • pCGS966 (Smith90, Smith92, Moir93) has ARS1 on both arms, Gal inducible extra copy production, NeoR for mammalian expression and a functional promoter for the Trp gene, unlike pYAC4.
  • pRML1 / pRML2 are similar to pJS97/8 (Haldi96)
    • see sequence information here

Sequencing primers for pRML1, pRML2 T3 for pRML1 T7 for pRML2 for both pRML1 & 2: attgtctcatgagcggatac,ampR-F ggtcacgctgcgcgtaacc,F1-F atggaaaaacgccagcaacg,322ori-R

References

  1. Hieter P, Pridmore D, Hegemann JH, Thomas M, Davis RW, and Philippsen P. Functional selection and analysis of yeast centromeric DNA. Cell. 1985 Oct;42(3):913-21. DOI:10.1016/0092-8674(85)90287-9 | PubMed ID:2996783 | HubMed [Hieter85]
  2. Mann C and Davis RW. Structure and sequence of the centromeric DNA of chromosome 4 in Saccharomyces cerevisiae. Mol Cell Biol. 1986 Jan;6(1):241-5. DOI:10.1128/mcb.6.1.241-245.1986 | PubMed ID:3537685 | HubMed [Mann86]
  3. Mortimer RK and Johnston JR. Genealogy of principal strains of the yeast genetic stock center. Genetics. 1986 May;113(1):35-43. DOI:10.1093/genetics/113.1.35 | PubMed ID:3519363 | HubMed [Moritmer86]
  4. Burke DT, Carle GF, and Olson MV. Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science. 1987 May 15;236(4803):806-12. DOI:10.1126/science.3033825 | PubMed ID:3033825 | HubMed [Burke87]
  5. Cottarel G, Shero JH, Hieter P, and Hegemann JH. A 125-base-pair CEN6 DNA fragment is sufficient for complete meiotic and mitotic centromere functions in Saccharomyces cerevisiae. Mol Cell Biol. 1989 Aug;9(8):3342-9. DOI:10.1128/mcb.9.8.3342-3349.1989 | PubMed ID:2552293 | HubMed [Cottarel89]
  6. Anand R, Villasante A, and Tyler-Smith C. Construction of yeast artificial chromosome libraries with large inserts using fractionation by pulsed-field gel electrophoresis. Nucleic Acids Res. 1989 May 11;17(9):3425-33. DOI:10.1093/nar/17.9.3425 | PubMed ID:2542900 | HubMed [Anand89]
  7. Sikorski RS and Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989 May;122(1):19-27. DOI:10.1093/genetics/122.1.19 | PubMed ID:2659436 | HubMed [Sikorski89]
  8. Sgaramella V, Ferretti L, Damiani G, and Sora S. A procedure for cloning restriction fragments of DNA as single inserts in yeast artificial chromosomes. Biochem Int. 1990;20(3):503-10. PubMed ID:2189412 | HubMed [Sgaramella90]
  9. Smith DR, Smyth AP, and Moir DT. Amplification of large artificial chromosomes. Proc Natl Acad Sci U S A. 1990 Nov;87(21):8242-6. DOI:10.1073/pnas.87.21.8242 | PubMed ID:2236036 | HubMed [Smith90]
  10. Wells RA, Germino GG, Krishna S, Buckle VJ, and Reeders ST. Telomere-related sequences at interstitial sites in the human genome. Genomics. 1990 Dec;8(4):699-704. DOI:10.1016/0888-7543(90)90257-u | PubMed ID:2276741 | HubMed [Wells90]
  11. Van Houten JV and Newlon CS. Mutational analysis of the consensus sequence of a replication origin from yeast chromosome III. Mol Cell Biol. 1990 Aug;10(8):3917-25. DOI:10.1128/mcb.10.8.3917-3925.1990 | PubMed ID:2196439 | HubMed [VanHouten90]
  12. Shero JH, McCormick MK, Antonarakis SE, and Hieter P. Yeast artificial chromosome vectors for efficient clone manipulation and mapping. Genomics. 1991 Jun;10(2):505-8. DOI:10.1016/0888-7543(91)90343-d | PubMed ID:2071158 | HubMed [Shero92]
  13. Burke DT and Olson MV. Preparation of clone libraries in yeast artificial-chromosome vectors. Methods Enzymol. 1991;194:251-70. DOI:10.1016/0076-6879(91)94020-d | PubMed ID:2005791 | HubMed [Burke91]
  14. Smith DR, Smyth AP, and Moir DT. Copy number amplification of yeast artificial chromosomes. Methods Enzymol. 1992;216:603-14. DOI:10.1016/0076-6879(92)16052-l | PubMed ID:1336106 | HubMed [Smith92]
  15. Ragoussis J, Trowsdale J, and Markie D. Mitotic recombination of yeast artificial chromosomes. Nucleic Acids Res. 1992 Jun 25;20(12):3135-8. DOI:10.1093/nar/20.12.3135 | PubMed ID:1620611 | HubMed [Ragoussis92]
  16. de Bruin D, Lanzer M, and Ravetch JV. Characterization of yeast artificial chromosomes from Plasmodium falciparum: construction of a stable, representative library and cloning of telomeric DNA fragments. Genomics. 1992 Oct;14(2):332-9. DOI:10.1016/s0888-7543(05)80223-x | PubMed ID:1427849 | HubMed [deBruin92]
  17. Deshpande AM and Newlon CS. The ARS consensus sequence is required for chromosomal origin function in Saccharomyces cerevisiae. Mol Cell Biol. 1992 Oct;12(10):4305-13. DOI:10.1128/mcb.12.10.4305-4313.1992 | PubMed ID:1406623 | HubMed [Deshpande92]
  18. Marahrens Y and Stillman B. A yeast chromosomal origin of DNA replication defined by multiple functional elements. Science. 1992 Feb 14;255(5046):817-23. DOI:10.1126/science.1536007 | PubMed ID:1536007 | HubMed [Marahrens92]
  19. Christianson TW, Sikorski RS, Dante M, Shero JH, and Hieter P. Multifunctional yeast high-copy-number shuttle vectors. Gene. 1992 Jan 2;110(1):119-22. DOI:10.1016/0378-1119(92)90454-w | PubMed ID:1544568 | HubMed [Christianson92]
  20. Moir DT, Dorman TE, Smyth AP, and Smith DR. A human genome YAC library in a selectable high-copy-number vector. Gene. 1993 Mar 30;125(2):229-32. DOI:10.1016/0378-1119(93)90334-y | PubMed ID:8462878 | HubMed [Moir93]
  21. Spencer et al. (1993). Targeted recombination-based cloning and manipulation of large DNA segments in yeast. Methods: A companion to methods in enzymology 5, 161-175 (no pubmed entry)

    [Spencer93]
  22. Kuhn RM and Ludwig RA. Complete sequence of the yeast artificial chromosome cloning vector pYAC4. Gene. 1994 Apr 8;141(1):125-7. DOI:10.1016/0378-1119(94)90139-2 | PubMed ID:8163163 | HubMed [Kuhn94]
  23. Spencer F, Hugerat Y, Simchen G, Hurko O, Connelly C, and Hieter P. Yeast kar1 mutants provide an effective method for YAC transfer to new hosts. Genomics. 1994 Jul 1;22(1):118-26. DOI:10.1006/geno.1994.1352 | PubMed ID:7959757 | HubMed [Spencer94]
  24. Hamer L, Johnston M, and Green ED. Isolation of yeast artificial chromosomes free of endogenous yeast chromosomes: construction of alternate hosts with defined karyotypic alterations. Proc Natl Acad Sci U S A. 1995 Dec 5;92(25):11706-10. DOI:10.1073/pnas.92.25.11706 | PubMed ID:8524833 | HubMed [Hamer95]
  25. Mahmood A, Kimura T, Takenaka M, and Yoshida K. The construction of mobilizable YACs and their direct conjugative transfer from E. coli to yeasts. Nucleic Acids Symp Ser. 1995(34):45-6. PubMed ID:8841544 | HubMed [Mahmood95]
  26. Mahmood A, Kimura T, Takenaka M, and Yoshida K. The construction of novel mobilizable YAC plasmids and their behavior during trans-kingdom conjugation between bacteria and yeasts. Genet Anal. 1996 Jul;13(2):25-31. DOI:10.1016/1050-3862(95)00146-8 | PubMed ID:8880145 | HubMed [Mahmood96]
  27. Haldi ML, Strickland C, Lim P, VanBerkel V, Chen X, Noya D, Korenberg JR, Husain Z, Miller J, and Lander ES. A comprehensive large-insert yeast artificial chromosome library for physical mapping of the mouse genome. Mamm Genome. 1996 Oct;7(10):767-9. DOI:10.1007/s003359900228 | PubMed ID:8854865 | HubMed [Haldi96]
  28. Kouprina N, Nikolaishvili N, Graves J, Koriabine M, Resnick MA, and Larionov V. Integrity of human YACs during propagation in recombination-deficient yeast strains. Genomics. 1999 Mar 15;56(3):262-73. DOI:10.1006/geno.1998.5727 | PubMed ID:10087193 | HubMed [Kooprina99]
  29. Cocchia M, Kouprina N, Kim SJ, Larionov V, Schlessinger D, and Nagaraja R. Recovery and potential utility of YACs as circular YACs/BACs. Nucleic Acids Res. 2000 Sep 1;28(17):E81. DOI:10.1093/nar/28.17.e81 | PubMed ID:10954614 | HubMed [Cocchia00]
  30. Veal EA, Ross SJ, Malakasi P, Peacock E, and Morgan BA. Ybp1 is required for the hydrogen peroxide-induced oxidation of the Yap1 transcription factor. J Biol Chem. 2003 Aug 15;278(33):30896-904. DOI:10.1074/jbc.M303542200 | PubMed ID:12743123 | HubMed [Veal03]

All Medline abstracts: PubMed | HubMed