OUR TEAM
LAB 3 WRITE-UP
Original System: PCR Results
PCR Test Results
| Sample Name |
Ave. INTDEN* |
Calculated μg/mL |
Conclusion (pos/neg)
|
| Positive Control |
+ |
--- |
N/A
|
| Negative Control |
- |
--- |
N/A
|
| Tube Label:1-A Patient ID: 57483 rep 1 |
1.81E+03 |
--- |
neg
|
| Tube Label:1-B Patient ID: 57483 rep 2 |
1.82E+05 |
--- |
neg
|
| Tube Label:1-C Patient ID: 57483 rep 3 |
6.32E+05 |
--- |
neg
|
| Tube Label:2-A Patient ID: 80175 rep 1 |
2.34E+06 |
--- |
pos
|
| Tube Label:2-B Patient ID: 80175 rep 2 |
4.57E+06 |
--- |
pos
|
| Tube Label:2-C Patient ID: 80175 rep 3 |
4.49E+06 |
--- |
pos
|
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Bayesian Statistics
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.
Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)
Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.
- A = frequency of cancer-positive conclusions = 9 / 20 = 0.45
- B = frequency of positive PCR reactions = 26 / 60 = 0.43
- P (B|A) = frequency of positive PCR given cancer-positive conclusion = 11 / 13 = 0.846
- P(A|B) = 0.85 = 85%
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
- A = Frequency of mismatch for pos = 3/9 = .33 = 33%
- B = Frequency of all mismatches = 5/9 = .55 = 55%
- P (B|A) = Probability the Patient will develop cancer= 3/10 =.3 = 30%
- P(A|B) = 30%
New System: Design Strategy
We concluded that a good system Must Have:
- [Must have #1 - A "must have" for our new devise is having the results be easy to determine. The reason for this would be that it would allow for more users of the devise and give them a simple to use product. We did not want to complicate the system and thus leading to users not wanting to use the product, our goal is to simplify the PCR machine to be more user friendly.]
- [Must have #2 - why? short, ~4 or 5 sentences]
We concluded that we would Want a good system to have:
- [Want #1 - Something that we wanted to include in our new design is to keep it portable and compact. When thinking about who would use the machine and where, there were many different situations that came up. Although the machine will be used in a lab or an office it will be able to take it other place without having to worry about weather the devise can with stand the situations it is in. This feature also is helpful because when storing the machine it is not very difficult but simply and easy.]
- [Want #2 - why? short, ~4 or 5 sentences]
We concluded that a good system Must Not Have:
- [Must Not Have #1 - One of the most important factors we want to change is the troublesome USB connection between the PRC Machine and the computer. This fault causes difficulty when trying to connect the machines information and the computer system that analyzes it. If this was to be fixed it would then lead to more accurate and reliable results. ]
- [Must Not Have #2 - why? short, ~4 or 5 sentences]
We concluded that a good system Should Avoid:
- [Should Avoid #1 - Since we are wanting the machine to be compact and portable, something we should avoid is how the energy consumption. If we have an inefficient power source or one that need direct connection that then makes the portability an un-needed feature. If we could find an outside source of power the could last an appropriate amount of time that would compliment thee portability feature and make our new design even better.]
- [Should Avoid #2 - why? short, ~4 or 5 sentences]
New System: Machine/ Device Engineering
SYSTEM DESIGN
KEY FEATURES
We chose to include these new features
- Feature 1 - Under the "must not have" section we are addressing the troublesome USB connection. The way we are going to address this problem by one of two ways. One way is to encase the metal tip of the cord with plastic that would have a better grip and not fall off as easily. Along with this, by have a indention on the machine where the USB would sit snug will help the connection be more stable and reliable. As a second idea to address this problem would be to add a safety lock feature on the cord. That would also increase the stability and the connection of the cord.
- Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section
INSTRUCTIONS
New System: Protocols
DESIGN
We chose to include these new approaches/ features
- Feature 1 = use one more positive and one more negative control -
Part of our problems were that on the very end when all the results were collected from all the groups that were involved in this BME is that we were not 100% on the results on each patient. Also we had trouble matching numbers with positive and negative results. to increase the accuracy of our results it would be good to place tow more tubes into the PCR machine that can serve as extra controls.
- Feature 2 = improving Fluorimeter imaging standards -
each group in the BME lab have used different smart phone, which means different types of cameras were used. each of those cameras have setting on that can not be changed. i think standarizing and raising the the cameras in the class would greatly improve the confidence that our results are correct.
Standard Application
Reagents supplied by the user :
- Template DNA
- Primer
- DNA polymerase
1. At room temperature acquire : A set of four dyes (blue, green, yellow, red), Sample containing (+,-,P1,P1,P1,P2,P2,P2), Pipette and tips, two rows of empty test tubes. then prepare yourself to make following mixes.
2.prepare following reaction mix :
| Component |
Volume
|
| Master mix |
10μL
|
| patient sample |
10μL
|
3.Sample mixed should contain sample of two patient each containg 3 replicates. As well as
a positive and a negative control. this should be divided into two rows of four test tubes
then can be instserted into PCR machine
4.Pre-heat PCR machine to 95 degree then place the prepared samples using standard parameters.
General Guidelines for Amplification by PCR
1. Acquire PCR machine and inspect its elements to ensure that the machine is read to be used
this will also require that a test runs are done to ensure that the PCR machine is ready to
go through appropriated cycles
2.Connect PCR machine to PC via USB and using Thermal Cycler Program specify the cycles that
are being runned. cycles that must be plugged into the software are following
| Stage |
Cycles |
Heat (Celsius) |
time
|
| 1 |
1 |
95 |
3 minutes
|
| 2 |
35 |
95 to 52 to 72 |
each 30 seconds
|
| 3 |
1 |
72 |
3 minutes
|
3.place two rows of four tubes into PCR that were prepared before, using PC click start and
allow time for the tests to take place leaving the PCR in a controlled environmental
Using SYBR Green Dye
Reagents supplied by the user :
- SYBR Green I
- DNA being tested
1.prepare the set up by setting up Single-Drop Fluorimeter then set a perforated and hydro-phobic
glass on the fluorimeter. the entire set uo should be covered by a box to ensure that the picture
exclude outside light. then platform for the camera should be made so that the camera can is perpendicular
and looks straight on the sample drop on the flourimeter that will be tested.
2.prepare the sample by mixing following samples, the solutions are acquired from the PCR machine that
was run previously.
| Solution |
Concetration of SYBR green
|
| 1 |
None (Water)
|
| 2 |
0.25 micrograms per ml
|
| 3 |
0.05 micrograms per ml
|
| 4 |
1.0 micrograms per ml
|
| 5 |
2.0 micrograms per ml
|
| 6 |
5.0 micrograms per ml
|
3.take each sample and place one drop on perforated and hydro-phobic glass. calibrate the camera and then
set the camera on its stance. take careful notes of the set up and the distances that the camera is from the sample
, the height of the camera... etc. close the dark box to block out all the outside light and take a picture.
repeat this process for all 6 samples.
Materials summery
| Supplied in the kit |
Supplied by User
|
- Water
- pipette
- Superhydrophobic surface
- cradle
- Smart phone
- Box
- plastic base
- small box to set up the phone
- software
- PCR
- Pipette and tips
- two rows of empty test tubes
|
- Water
- Set of read SYBR green(5 samples)
- master mix
- Smartphone
- A set of four dyes (blue, green, yellow, red)
- Sample containing (+,-,P1,P1,P1,P2,P2,P2)
|
New System: Research and Development
BACKGROUND
"CHEK2" gene is short for: Checkpoint Kinase 2. For humans, or Homo sapiens, the DNA is made up of proteins that have specific coding in an A-T or G-C formatting. CHEK2 is a mutation that changes that normal allele pattern of "ATT" to "ACT". This mutation prevents control of the cell cycle regulators that ultimately prevent mitosis from occurring. This can lead to sarcomas, breast cancer, and brain tumors.
DESIGN
To amplify the cancer associated sequence a primer pair that has a change in the normal allele forward primer needs to be designed; the "cancer allele forward primer". Vice versa, thr "cancer allele reverse primer" will stay the same.
Normal allele forward primer:CCCAGGATTTTTGAGAATGTA
Cancer allele reverse primer:GGGTCCTAAAAACTCTTACAT
Primers for PCR
Cancer allele forward primer:CCCAGGATTTTGAGACTGTA
Cancer allele reverse primer:GGGTCCTAAAAACTCTTACAT
The cancerous gene will produce a positive result, while the non-cancer gene will give a negative result, because the primers are designed to amplify cancerous DNA. Therefore, the cancerous mutation cannot bind to normal DNA, ultimately meaning that amplification cannot occur.(http://openwetware.org/wiki/BME103_s2013:T900_Group8)
Our primers address the following design needs
- Design specification 1 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
- Design specification 2 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
- Etc.
|