User:Jarle Pahr/Promoters
From OpenWetWare
Jump to navigationJump to search
Notes on various promoters:
OmpA: Among the strongest promoters in E. coli (1, cited in 2).
XylS/Pm system
Lac promoter
lldP
GreA
Promoter sequences
| Description | Length (bp) | Sequence | Location (absolute) | Location (relative) | Comment |
|---|---|---|---|---|---|
| LacUV5 | Constitutive promoter | ||||
| rrnB P1 73 bp fragment | gttgcgcggtcagaaaattattttaaatttcctcttgtcaggccggaataactccctataatgcgccaccact | -70 to +3 | Strong promoter. Inhibited by ppGpp. | ||
| GreA promoter 60bp fragment | ggcgcaacgccctataaagtaaacgatgacccttcgggaacttcagggtaaaatgactAt | -58 to +2 | |||
| PcnB | |||||
| MazEF | |||||
| IraP | |||||
| His | |||||
| Thr |
