User:Victoria Keenan/Notebook/Biology 210 at AU

From OpenWetWare
Revision as of 19:02, 23 March 2014 by Victoria Keenan (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

ZEBRAFISH LAB:

March 23rd, 2014: Results from lab done on: March 6th, 2014

Purpose: To determine the difference in size, motility, and behavior between the embryos and development of Zebrafish in the control and caffeine plate.

Hypothesis/Prediction: The observations that were observed on day 4 and 7 will continue to be seen within the zebrafish development, however the results will be more drastic.

Procedure: 1) Both Zebrafish plates were obtained and analyzed under a microscope for final investigations. 2) Any waste/egg shells/dead fish were removed with a transfer pipet. 3) The fish fixed from both the control and caffeine were poured onto a depression slide then analyzed under the microscope

Observations: • The water level in both plates were critically and fatally low • All fish in both plates were dead • The fish were never fed the paramecium as they were supposed to be given

Conclusion: The actual observations of the zebrafish embryo after the results were analyzed were very different than what we expected to learn after reading the article on zebrafish and caffeine. The eyes on the caffeine fish are bigger than those of the control fish. The heads for both the zebrafish in water and zebrafish in caffeine were overall about the same. The tails of the caffeine fish vary more than those of the control, despite the fact that early on in the experiment the zebrafish in the caffeine seemed to vary less in size. It was not surprising that the one caffeine fish had a curvature in the spine, due to the retardation in growth. One question that I still have is as to why the heads of some of the zebrafish were darker that others. Was this a factor that we should have paid more attention to? Overall most of the data that we collected was the complete opposite of the results from the literature we read before the actual experiment.


Results from lab done on: February 27th, 2014 (Day 7)

Purpose: To discover any differences in size, motility, and behavior between the embryos and development of Zebrafish in the control and caffeine plate.

Hypothesis/Prediction: The observations from Day 4 will continue to be the same, however they will be a lot more obvious.

Procedure: 1) Both Zebrafish plates were obtained and analyzed under a microscope. 2) Any waste/egg shells/dead fish were removed with a transfer pipe. 3) The number of hatched fish and embryos present were counted. 4) Differences from Day 4 regarding size, motility, appearance, behavior, etc. were taken. 5) 2 Zebrafish from each plate were fixed in their own tube (one tube for the control, the other tube for the caffeine) in paraformaldehyde for one week.

Observations: Control group: Fish present: 14. Fish dead: 0. Loss of fish: 4 from this week, 2 from the week before. Overall observations: Movement seems to be a little slower (more lethargic) than the week before, eye and tail movement still seem healthy and normal, no unnecessarily agitated or frantic movement present. How many taken for fixing: 2 Caffeine group: Fish present: 18. Fish dead: 0. Loss of fish: 2 from this week, 0 from the week before. Overall observations: The one unhatched embryo had hatched, the tails and heads are visibly smaller than those of the control group, all are thinner than those of the control group, more sporadic and rapid movement. How many were taken for fixing: 2.

Conclusions: Where did the missing fish go? There were no dead fish in the plate, so are the fish eating each other? The caffeine group followed the trend of Day 4, which matched the trend in the literature.


Results from observations done on February 24th, 2014. (Day 4) Observation done from 1:00-1:45pm

Purpose: To determine any differences in size, motility, and behavior between the embryos and development of Zebrafish in the control plate and the caffeine water plate.

Hypothesis/Prediction: The Zebrafish grown in caffeine water environment will have motility defects or abnormalities as well as be smaller in appearance. It is also expected that there will be more deaths in the caffeine water plate than in the deer park water plate.

Procedure: • Both Zebrafish plates were obtained and analyzed under a microscope • All shell matter was removed with a transfer pipet • The number of hatched fish and embryos present were counted • Observations regarding size, motility, appearance, behavior, etc. were taken • 5.0 mL of deer park water and the caffeine water were added to the control and caffeine plates respectively

Observations: Control: See empty egg shells. Some significantly smaller than others. Swam away from pipet. Grey/black speck observed. Possibly dirt? Doesn't seem to look like an embryo. The zebrafish moved when the petri dish was moved. Rapid/swift/sharp movements. Visible tail movement. Some zebrafish are visibly more active than others. Seems like some of the zebrafish are healthier than others. All egg shells were removed. Seems to attach their head to the outside of the petri dish. Believe that 18 are present, hard to tell because of their movement. Where did the other 2 go? All zebrafish observed had 2 black, normal shaped eyes. Tail is longer than its head. The tail is translucent with many black specks. They range from about 3.4mm-5.0mm. All embryo hatched. Maybe the black speck was a dead embryo? Added 5.0mL of H20 to the petri dish.

Caffeine: Can see many more egg shells. All egg shells were removed. Many more of the zebrafish are motile than in the control petri dish. There is one embryo that is still in the egg, it is moving, but it seems as if the development for this embryo is delayed. Size varies less: 2.7mm-3.8mm. Many of them look like they are the same size. Swift/brief/rapid movement. More panicky than control when the pipet was inserted into the petri dish. They also seem to swim away from the light more than the control did. Eyes appear smaller and move less. 19 of the zebrafish hatched, 1 was not hatched. Closer together than control group. More translucent overall. Tail movement is less visible. Added 5.0mL of caffeine to the petri dish.

Photos: Picture 1: http://instagram.com/p/k5CSF8G6cO/ Picture 2: http://instagram.com/p/k5CXM6m6cT/

Conclusions: The Zebrafish in the caffeine plate are overall smaller, but vary less in size and movement. The Zebrafish in the caffeine plate are overall more hectic and frantic in terms of motion and response. Additionally, their eyes are smaller and move less. Therefore, the literature is confirmed in the sense that the fish are smaller and have motor defects.


Results from observations done on February 21st, 2014 There were no changes in the zebrafish embryo. There were no deaths in either petri dish (control and caffeine). The water level for both petri dishes were the same as yesterday.


Results from lab done on February 20th, 2014

Goal/Objective: To learn the stages of embryonic development, compare embryonic development in different organisms, and to set up an experiment to study how environmental conditions affected embryonic development.

Steps: Zebrafish Experimental Procedure- 1) Observe the zebrafish embryos and determine their developmental stage for the first time reading. 2) Set up the control group and the test group in covered petri dishes. Each group tests one variable there will be at least two petri dishes of embryos (Control: Water Test: Caffeine) 3) Use 20 mLs of Deerpark water and 20 healthy translucent embryos per dish. Use a dropper to transfer the eggs to the dishes with the appropriate water. 4) Organize the observation schedule and procedure. Make observations and carefully record those over the next two weeks. 5) Be sure to visit and check on the zebrafish embryos tomorrow and on monday.

Raw Data: Over the next few weeks we will be observing the following information in regards to the zebrafish: living vs. dead, color change, visible difference in movement, visible size change, approximate age, water amount added. In the photos section below, there is a chart with the determined developmental stages for all 40 of the zebrafish embryo.

Observations: Caffeine water plate: 12 hours old: 9 embryos. 14 hours old: 6 embryos. 16 hours old: 2 embryos. 18 hours old: 3 embryos. No abnormalities seen in color, shape, or movement. No other external stimuli present Control, deer park water, plate: 12 hours old: 8 embryos. 14 hours old: 3 embryos. 16 hours old: 5 embryos. 18 hours old: 4 embryos. No abnormalities seen in color, shape, or movement. No other external stimuli present

Photos: Picture 1: http://instagram.com/p/k5B5m9G6bk/ Picture 2: http://instagram.com/p/k5B7XxG6br/ Picture 3: http://instagram.com/p/k5CISxm6cD/

Conclusion: It was very interesting to observe the different developmental stages that our 40 zebrafish embryo are using the dissecting microscope. I look forward to seeing how caffein will effect the overall growth and development of the zebrafish.


TRANSECT LAB:

March 9th, 2014: Results from observations done on February 27th, 2014

Goal/Objective: To identify the three different types of bacteria that were found in the transect.

Steps: The PCR reaction done in lab 3 was used to sequence DNA from the 16S rRNA gene. Using the sequences obtained from blackboard, copy and paste the sequences into NCBI blast. Then identify the three different types of bacteria found within the transect.

Raw Data: Two out of the three types of bacteria observed were able to be identified. The chart, which was provided during lab 3, has been updated and included in the photos section to include the identification of the different bacteria.

Sequence 1: AGCGGTAGAGATTCTTCNGAWTCTKRAKAGCGGMGTRCRGRTKMRGAACACGKRWGCAASCTGSCTTTRTSGSGGGGATARCCTTTCKAAAGGAAGATTAATMCCCCATAATATATTAARNNNNATCASKKGAYMTTNNNGMMAASTCCGGTGGRWAAWGATGGGCWCGSRCAAGATTAGWKAGWTGGTAAKGTRRCGGCWANCCAAGTYMGTGATCTTTATGGGGCMTGAKAGGGTGATCCCCCACWCTGGTAMYGAGACMCKGACCAGACTCSTACRGKASGCAGCAGTGAGGAATATTGGACWATGGGTGARAGCCTGATCCMGCCATCCCGCGTGAASGATGACGGCCCTATGRGTTGTAATCTTCTTNTGTATWTGGATAAACCTTNNCNACKGT

Sequence 2: TCNAAACAGCAAAGTATTAATTTACTGCCCTTCCTCCCAACTTAAAGTGCTTTACAATCCGAAGACCTTCTTCACACACGCGGCATGGCTGGATCAGGCTTTCGCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGACTGATCATCCTCTCAGACCAGTTACGGATCGTCGCCTTGGTGAGCCATTACCTCACCAACTAGCTAATCCGACCTAGGCTCATCTGATAGCGCAAGGCCCGAAGGTCCCCTGCTTTCTCCCGTAGGACGTATGCGGTATTAGCGTTCCTTTCGAAACGTTGTCCCCCACTACCAGGCAGATTCCTAGGCATTACTCACCCGTCCGCCGCTGAATCAAGGAGCAAGCTCCTCTCATCC

Sequence 3: TACACGTAGAAAGGTTTATTCCCTGACAAAAGCAGTTTACAACCCATAGGGCAGTCATCCTGCACGCGGCATGGCTGGTTCAGAGTTGCCTCCATTGACCAATATTCCTTACTGCTGCCTCCCGTAGGAGTCTGGTCCGTGTCTCAGTACCAGTGTGGGGGATTCTCCTCTCAGAGCCCCTAGACATCGTAGCCTTGGTGAGCCGTTACCTCTCCAACTAGCTAATGTCACGCGAGCCCATCCATATCCTATAAATATTTGATCAAAAACCGATGCCGGTAAATGATGTTATGCGGTGTTAATCTCTCTTTCGAGAGGCTATCCCCCTGATATGGGTAGGTTGCTCACGCGTTACGCACCCNTGCGCCACTCTCATCAGTTNGTAGCAAGCTACTCCCTGAA

Photos: Picture 1: http://instagram.com/p/lVMUXkG6SU/

Conclusions: It was interesting to observe how only two of the three different bacteria observed were able to be identified. Because the bacteria on the 10^-3 nutrient plate was unidentifiable, I think that it would be interesting to further investigate this. The PCR reaction should be done again and then sequenced for DNA. If the results once again come back as unidentifiable, then there could be a new type of bacteria on AU's campus. It would be interesting to test this bacteria further and possibly discover a new type of bacteria. Another thing that I found interesting was how some of the findings between lab 3 and todays data were inconsistent. For example the pseudomona is a gram negative bacterium, however when we observed it we believed it to be gram positive. This data would need to be re-analyzed to confirm whether or not we were actually correct with the data we collected. VK


February 23th, 2014: Results from lab done on February 20th, 2014

Goal/Objective: To understand the importance of invertebrates and to learn how simple systems (including specialized cells and overall body plan) evolved into more complex systems.

Steps: Transferred the solution from the Beriese Funnel, made during last weeks lab, into two separate Petri dishes (one from the top and one from the bottom). The Perti dishes were then examined under a dissecting microscope.

Raw Data: All the organisms observed under the dissecting microscope were very small, and were unable to be seen with the naked eye. All the organisms observed were found in the soil of our transect. A description and pictures of the invertebrates found can be seen in the photos section below.

Photos: Picture 1:http://instagram.com/p/k5BGbjm6aD/ Picture 2: http://instagram.com/p/k5BH3mm6aH/ Picture 3: http://instagram.com/p/k5BJZYG6aL/ Picture 4: http://instagram.com/p/k5B0UQG6bc/

Conclusion: Overall, it was very interesting to observe the invertebrates that thrive in our transect. I did not expect to see that many living organisms within the soil of our transect seeing as it was surrounded by dead plants, leaves, and trees.


February 18th, 2014: Results from lab done on February 6th, 2014

Goal/Objective: To understand the characteristics and diversity of plants and to appreciate the function and importance of fungi.

Steps:

Procedure 1: Collecting Five Plant Samples from the Transect 1) Obtain two plastic bags and proceed to the transect 2) Obtain some leaf litter from the transect. Leaf litter can be obtained from an area of the transect that has soft soil as well as dead leaves/ground covering it. Be sure to only dig into the crumbly top layers of the soil, but be sure to collect all the plant matter from that area, and place it in one of the bags. 3) Take a representative sample from five different plants found within the transect. Be sure to note where they came from in a picture. Take a picture of the whole tree or plant, because this will be important for identifying the plant later on in lab. 4) Look for any seeds, pine cones, or flowers and bring them back to lab as well. 5) Describe the plants collected (found in table 1 below)

Procedure 2: Plant Vascularization 1) Observe moss, Mnium 2) Examine the cross section side of a lily stem 3) Describe the vascularization of each plant collected from the transect (found in table 1 below)

Procedure 3: Plant Specialization 1) Observe moss and angiosperm 2) Describe the shape, size, cluster arrangement of leaves from the plants collected from the transect (found in table 1 below)

Procedure 4: Plant Reproduction 1) Observe moss, Polytrichum 2) Identify whether the seeds from the plants collected from the transect were either monocot or dicot (found in table 1 below)

Procedure 5: Observing Fungi 1) Examine black bread mold under the dissecting microscope

Procedure 6: Setting up the Beriese Funnel to Collect Invertebrates 1) Pour about 25 mL of the 50:50 ethanol/water solution into the flask 2) Fit a piece of the screening material into the bottom of the funnel. Tape the sides of the screen, so that the leaf litter does not fall into the preservation 3) Place the funnel into the neck of the flask 4) Place a lighted 40 watt lamp above the funnel with the incandescent bulb about 1-2 inches from the top of the leaf litter 5) Cover everything with foil 6) Leave the lighted setup on the lab bench for a week

Raw Data: We observed the plant vascularization, speciation, and reproduction of moss and angeosperms, and then used the knowledge that we gained from our observations to classify the vascularization, specialization, and reproduction of the 5 plants we collected from the transect (all the data can be found in table 1 below). During our observations we measured the height of moss as well as the height of a lily. The moss was measured to be about 2” in height, while the lily was a lot taller, about 25”. The lily can be used to describe the effects of having vascularization. Because the lily has vascularization, it is able to grow further away from the ground, doesn’t have to sit in water, and the reproduction doesn’t depend on water. The stems of the lily contain the pith, protoxylem, xylem, phloem, sclerenchyma, cortex, and epidermis. It is the responsibility of these parts of the plant to provide the nutrients and water to the rest of the plant. It is this fact that causes a huge variation in plant height. Those plants, like the lily, who have vascularization are able to grow further away from the ground because they have a system that will provide the rest of the plant with water; where as the moss did not have vascularization, causing the moss to not be tall because it needs to stay close to the ground to get its water source. During lab we also observed fungi by looking at black break mold under the dissecting microscope. Fungi sporangia are involved in asexual reproduction of spores. In fact, the asexual sporangia are a very important aspect for the reproduction on fungi. It was evident that we were observing fungi under the dissecting microscope because of the spores, visible sporangia cells, found within the sample. These cells were on the tip of the mycelium or hyphae, and can be observed in the images below. The last part of this lab was making the Beriese funnel. Within our bag of leaf litter there were many dead leaves as well as a small amount of wet soil from our sample. We also placed small pieces of leaves into the funnel as they were covered with wet soil. When looking at the sample with the naked eye we were unable to see any signs of living organisms. A picture of the Beriese funnel and the leaf litter can be found below.

Photos: Picture 1: http://instagram.com/p/kk5beMG6UI/ Picture 2: http://instagram.com/p/kk5dmsG6UL/ Picture 3: http://instagram.com/p/kk5fvHm6US/ Picture 4: http://instagram.com/p/kk5hl-G6UV/ Picture 5: http://instagram.com/p/kk5kQsG6UX/ Picture 6: http://instagram.com/p/kk5l21G6UY/ Picture 7: http://instagram.com/p/kk5n5iG6UZ/ Picture 8: http://instagram.com/p/kk5p4lm6Uc/ Picture 9: http://instagram.com/p/kk5y68m6Ur/ Picture 10: http://instagram.com/p/kk57ZGm6U8/ Picture 11: http://instagram.com/p/kk6ILiG6VO/ Picture 12: http://instagram.com/p/kk6T7UG6Vg/ Picture 13: http://instagram.com/p/kk6WwMG6Vn/

Conclusion: After observing the five different plants that we found within the transect, we were unable to classify four out of the five plants. We were able to classify the American Holly tree due to the fact that we remembered the berries growing on it when we first visited the transect on the first day of lab. It was more difficult to classify the other plants due to the fact that most of the leaves were dead, as well as the fact that we did not remember whether or not the remaining four unidentified plants grew flowers or berries, both which would have been very helpful to know when classifying the plants. Besides observing and attempting to classify the five plants from the transect, I found it very interesting getting to learn about vascularization. Observing the moss and the lily plant brought the whole concept to life because we were able to see what exactly vascularization does to a plant: giving it the ability to grow tall and away from water because it has a system that will bring all the water up to the top of the plant. I also am interested in observing all the invertebrates that are in our leaf litter. It is fascinating to know that there are forms of life growing within our transect, even though we were not actually able to see them with our naked eye. VK


February 12th, 2014: Results from lab done on January 30th, 2014.

Goals/Objectives: To understand the characteristics of bacteria, to observe antibiotic resistance, and to understand how DNA sequences are used to identify species.

Steps:

Procedure 1: Quantifying and Observing Microorganisms 1) Obtain Hay infusion culture and note any differences in smell or appearance 2) Observe the handout on how to characterize colony morphology 3) Count the total number of colonies on each of the agar plates and record the data on table 1 (picture is provided in the photos section)

Procedure 2: Antibiotic Resistance 1) Observe the colonies that grow on the tetracycline plates

Procedure 3: Bacteria Cell Morphology Observations 1) Obtain and observe a prepared slide containing different types and shapes of bacteria. This allows for a base idea of the different morphologies with the 4X, 10X, and 40X 2) Place a small drop of oil on the slide and observe the 100X oil immersion lens. Be careful not to get oil on the 40X 3) Choose two samples from the nutrient agar plate and one from the nutrient agar plate with the tetracycline. These samples will be used later to make a wet mount and a gram stain 4) Take all 3 samples, scrape them onto a slide containing a drop of water, and then sterilize the slide over an opened flame until the drop of water is no longer visible. Cover the slide with a cover slip. Observe the slide under a microscope with a 10X and 40X objective lens. Notice the cell shape and motility 5) Take a new slide and heat it over a bunsen burner with the bacteria side up. Cover the slide with crystal violet dye for 1 minute. Cover the slide with gram's iodine mordant for 1 minute and then carefully rinse off the dye. Decolorize the slide by covering the slide with 95% alcohol for 10-20 seconds. Rinse the slide off until it is completely decolorized. Cover the slide with safranin stain for 20-30 seconds. Rinse the slide again. Blot the excess water off the slide using a wet paper towel. Observe the slide under 4X, 10X, and 40X. Then observe the slide under the 100X oil immersion lens

Procedure 4: Start PCR Preparation for DNA Sequencing Identification 1) Isolate DNA from the same bacterial colonies as before. 2) Transfer each colony into separate 100 microliters of water in a sterile tube 3) Incubate each tube at 100 degrees Celsius for 10 minutes 4) Centrifuge each tube for 1 minute. Be sure to balance the centrifuge 5) Place 5 microliters of the supernatant from each of the tubes into a new tube containing 27F and 519R primer sequence. This will help to locate the 16S rRNA gene 6) PCR reaction will be completed next week in lab.

Raw Data: We observed that the plates that contained only the nutrients produced a law, we were unable to see any colonies with the naked eye; whereas the plates that contained the tetracycline produced visible colonies. Out of all 7 agar plates, the only plates that had any growth whatsoever were 10^-3 and 10^-5 in both the nutrients and nutrients with tetracycline. The agar plates that contained the nutrients and tetracycline had a lot less growth than those that contained the tetracycline, because we were able to count and physically see each individual colony on the plates with nutrients. This means that the colonies that did grow were immune to the tetracycline. The plates that contained only nutrients were a lot more difficult to view the colony growth. On these plates a lawn grew, meaning that the colonies grew together in large quantities.

Photos: Picture 1: http://instagram.com/p/kV7iAmm6df/ Picture 2: http://instagram.com/p/kV7th3G6dq/ Picture 3: http://instagram.com/p/kV73FGG6d0/ Picture 4: http://instagram.com/p/kV7_7VG6d9/ Picture 5: http://instagram.com/p/kV8T3Bm6eP/ Picture 6: http://instagram.com/p/kV8hMpm6ed/ Picture 7: http://instagram.com/p/kV8rlrG6eo/ Picture 8: http://instagram.com/p/kV8z1Wm6ew/ Picture 9: http://instagram.com/p/kV86hLm6e6/

Conclusion: There was bacterial growth on both the nutrients agar plate and the nutrients/tetracycline agar plate for 10^-3 and 10^-5. The plate with just the nutrients had a lot more growth than the plates with the tetracycline on it because tetracycline prohibits enzyme reactions that are important for bacterial cells, essentially stopping protein synthesis. It was very interesting being able to observe the different characteristics of each colony on the different agar plates. VK


January 29th, 2014: Results from lab done on January 23rd, 2014.

Goals/objectives: To understand how to use a dichotomous key and to understand the characteristics of Algae and Protists.

Steps:

Procedure 1: How to Use a Dichotomous Key 1) Make a wet mount of a sample with the known organisms and observe with the microscope at 4X and 10X. Because many of the organisms are motile it may be difficult to observe them with the 40X objective lenses. 2) Focus on one organism and characterize it. Be sure to determine the size with the ocular micrometer. 3) Obtain a dichotomous key and observe/describe eight known organisms.

Procedure 2: Hay infusion culture continued 1) Bring your Hay infusion culture to your work area without disturbing the contents of the jar. Take notice of the smell, and describe the appearance of the contents of the jar. Make sure to take pictures of it. 2) Take a few samples for microscopic observation. Be sure to observe two organisms from at least two different niches, three if you want. It is a good idea to remove some plant matter as one of the areas to observe. 3) Characterize at least 3 organisms from each of the two areas of your culture (you should observe a total of 6 organisms). Determine whether the organisms are mobile, immobile, protozoa, algae, or others? Are they photosynthesizing or not? Be sure to measure the size of each organism with the ocular micrometer.

Procedure 3: Preparing and Plating Serial Dilutions 1) Obtain four tubes of 10 mls sterile broth and label them 2, 4, 6, 8. Also make sure you have a micropipeter that is set to 100 microliters and tips. 2) Find four nutrient agar and four agar plus tetracycline plates. Make sure all the tetracyclin plates are labeled with “tet”. Label one plate from each of the two groups, 10^-3, 10^-5, 10^-7, and 10^-9. Be sure to put your initials on all of the plates. 3) Swirl the Hay Infusion Culture to mix up all the organisms. Then take a 100 microliters from the mix and aseptically add this to the 10 mls of broth in the tube labeled 2 for 10^-2 dilution or a 1:100 dilution. Swirl the inoculated tube well. 4) Take 100 microliters of broth from tube 2 and inoculate tube 4. Swire the tube to make sure that the liquids are well mixed. Repeat this step two more times for 10^-6 and 10^-8 dilutions. 5) Take the 100 microliters from the 10^-2 tube and aseptically place on the surface of the nutrient agar plate labeled 10^-3. Carefully spread the sample on the plate. Repeat this procedure on the tet plate labeled 10^-3. Repeat this procedure with the number 4 tube on the 10^-5 plates and number 6 tube on the 10^-7 plates and the number 8 with the 10^-9 plates. 6) Leave the plates in the lab room to incubate for one week.

Raw Data: Today we observed the hay infusion cultures from last week. Our hay infusion smelt like the outside after it rains (wet dirt and wet plants). There was a lot of growth at the bottom and the top of the jar, especially on the leaf, which can be found at the bottom of the jar. We decided to collect a sample from the top area of the jar as well as the bottom area of the jar. We noticed that while observing these two locations under the microscope, although it seemed like there was a lot of growth at the top of the jar we were unable to find a lot of protozoa in this area. We were able to find one protozoa, a circular type one that moved, spun around in circles. We however were unable to identify it. Besides this we also noticed a lot of dirt in the field of view. Overall, there was not a lot of activity, and not nearly as much growth as we suspected at the top of the jar. Despite the fact that we were unable to find protozoa at the top of the jar, we noticed a lot of them within the sample that we took from the bottom of the jar. The first protozoa that we observed was the colpidium. This protozoa moved very quick. There were about 6 different colpidium within one field of view. We noticed an oral grove. It also looked as if the colpidium was eating something, but we are not too sure what it was consuming, or if it in fact was consuming anything at all. The colpidium were between 70-100 micrometers in length. Besides the colpidium we also observed many paramecium, Like the colpidium, the paramecium also seemed to move very fast. These protozoa were long and somewhat oval shaped. They were also covered in cilia, which helps them to move. Wherever we looked on the slide we were able to observe at least one paramecium in each field of vies. These protozoa were about 200-300 micrometers in length.

Photos: Picture 1: http://instagram.com/p/kVuIVbm6bt/ Picture 2: http://instagram.com/p/kVuPzzG6b8/ Picture 3: http://instagram.com/p/kVuRzPG6b9/ Picture 4: http://instagram.com/p/kVuYpHm6cH/ Picture 5: http://instagram.com/p/kVutRUm6cu/ Picture 6: http://instagram.com/p/kVu3u0m6c9/ Picture 7: http://instagram.com/p/kVu925m6dM/ Picture 8: http://instagram.com/p/kVvBTUm6dT/

Conclusion: Today we got to observe many different protozoa that were in our Hay infusion. I found it very interesting getting to observe the very few life forms that were found on the top layer of the culture, while there were so many life forms at the bottom of the culture. It would make sense that there were more life forms at the bottom of the jar than at the top because the leaf and other organisms acted as a source of nutrients, allowing the protozoa to live, grow, and reproduce. VK


January 21st, 2014: Today it snowed in DC. I decided to visit the transect to see what it looked like in a different environment. The whole area was covered with snow. All the bushes (both tall and small) were covered with snow as well as the cement pathway and the birds nest that we found last weekend. It did not seem like there was much activity going on in or around the transect. The snow was clean and there were no footprints around the transect, causing me to believe that there were no people or animals around the location from the time it started snowing until now. VK

Photo: Picture 1: http://instagram.com/p/kVqACKG6VC/ Picture 2: http://instagram.com/p/kVqCdnG6VF/


January 16th, 2014: Results from lab done on January 16th, 2014.

Goal/Objective: Observed the designated 20 by 20 feet transect for the group. Record the physical description, biotic factors, and abiotic factors for the transect. Take pictures of the transect and different factors that are found in it. Collect a sample of the soil/surface plant from the transect. Lastly, create a Hay Infusion culture for the transect, whcih will be observed in one week.

Steps: Locate the designated transect. Describe the characteristics of the transect, including: location, topography, abiotic, and biotic factors. Use a sterile 50 mL conical tube to collect a soil and ground vegetation (grass, plants, etc.) sample. Take pictures of the transect, which will act as a source of comparison for when visiting the transect at a later date. Make a Hay infusion culture using the sample collected from the transect. Weigh 10 to 12 grams of the collect sample and place it in a plastic jar with 500 mLs of water. Add 0.1 gm dried milk to the jar. Mix the contents of the jar for about 10 seconds. Label the jar. Remove the top of the jar and place it in the corner of the lab room (or where the lab instructor directs you to put it).

Raw Data: Group 3. Location: Tall Bushes. Biotic Factors: Short plants, tall plants, bacteria within the soil, worms, squirrels, a bird in a birds nest. Abiotic Factors: two sprinkler heads, two light posts, a cement path, stones, and trash- cigarette butt. Description of Area: This 20’ by 20’ square is located on American University’s campus between Hughes and the tunnel. It’s composed mostly of bushes, tall and small, that seem to be dead. Some of the bushes have brown leaves on them while other bushes have no leaves at all. The area itself is partially shaded by the surrounding buildings. It is in a secluded location, acting as a location for animals to dwell. There are many plants around this dead location, however all the plants are green and seem to be surviving the winter, which could be due to the fact that they are not shaded by buildings, allowing them to receive sunlight.

Photos: Picture 1: http://instagram.com/p/kVpZAYG6UD/ Picture 2: http://instagram.com/p/kVpoJQG6Ue/

Conclusion: This lab is the basis for the rest of the labs in which we will conduct during our transect section of this lab. It is important to observe and note any changes in the transect. Although I do not feel like there was much we could change to this part of the experiment, I think it would be interesting if we could a Hay infusion now and at the end of the semester (two different seasons: winter and spring). I think it would be interesting to observe the different factors and growth that may occur during different times of the year, especially in our transect because of the fact that most of the area was a shady, secluded location. Seeing as not many people go to this location, we could observe all the animal and plant life that may be found within the transect during the spring. VK