User:Jenna Brownrout/Notebook/Biology 210 at AU

From OpenWetWare
Revision as of 02:09, 23 March 2015 by Jenna L. Brownrout (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

File:Brownrout Jenna Lab6oww.pdf

File:Brownrout Jenna Lab5oww.pdf

File:Brownrout Jenna Lab4oww.pdf

File:Brownrout Jenna Lab3oww.pdf

File:Brownrout Jenna Lab2oww.pdf

File:Brownrout Jenna Lab1oww.pdf


ATGCAGTCGAGCGGATGACGGGAGCTTGCTNTCNNGATTCAGCGGCGGACGGGTGAGTA ATGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTCTCGAAAGGGACGCTAATACCGCATACGTCCTACGGGAGAAAGC AGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGA CGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTG GGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTT AAGTTGGGAGGAAGGGCATTAACCTAATACGTTAGTGTTTTGACGTTACCGACAGAATAAGCNCCGGCTAACTCTGTGCC AGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCNNAATTACTGGGCGTAAANCGCNCGTNNNTGGTTTGGGGNAGT TCCATATGAAAGCCCCTCGGTCTACCCNGGGGGGGGGCGGT

We found our sequence was for gram-negative bacteria, Pseudomonas.

"Pseudomonas is a genus of Gram-negative, aerobic gammaproteobacteria, belonging to the family Pseudomonadaceae containing 191 validly described species.[1] The members of the genus demonstrate a great deal of metabolic diversity, and consequently are able to colonize a wide range of niches.[2] Their ease of culture in vitro and availability of an increasing number of Pseudomonas strain genome sequences has made the genus an excellent focus for scientific research; the best studied species include P. aeruginosa in its role as an opportunistic human pathogen, the plant pathogen P. syringae, the soil bacterium P. putida, and the plant growth-promoting P. fluorescens. Because of their widespread occurrence in water and plant seeds such as dicots, the pseudomonads were observed early in the history of microbiology. The generic name Pseudomonas created for these organisms was defined in rather vague terms by Walter Migula in 1894 and 1900 as a genus of Gram-negative, rod-shaped and polar-flagellated bacteria with some sporulating species,[3][4] the latter statement was later proved incorrect and was due to refractive granules of reserve materials.[5] Despite the vague description, the type species, Pseudomonas pyocyanea (basonym of Pseudomonas aeruginosa), proved the best descriptor.[5]" Wiki!