'Round-the-horn site-directed mutagenesis

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
‘Round the Horn Site-directed mutagenesis
‘Round the Horn Site-directed mutagenesis
 +
 +
==Background==
 +
 +
I was in grad school and had to make several amino acid substitutions at the same position in a cloned gene.  I came up with this protocol and called it "Around-the-Horn" a phrase used in baseball meaning to throw that ball through all of the base positions.  The phrase originally referred to "Rounding Cape Horn of South America" a very difficult, but rewarding journey ("Round-the-horn" is not difficult).  Subsequently, a group published a paper describing the process, but I was first and take full credit and have used it in ways not described by others.
 +
 +
I was used to doing "Quick change" (Stratagene) wherein two complementary oligos containing the desired mutation are used to prime extensions all the way around the plasmid.  Quickchange is a linear amplification (not PCR) and each round of extensions is performed on the plasmid template.  There are several problems and limitations with Quickchange:
 +
 +
*The Size of the muation is limited to a few base pairs.
 +
 +
*Each primer has to be long to provide sufficient annealing on both sides of the mutation (money).
 +
 +
*Non-optimal extension conditions will result in "end-filling" wherein the polymerase fills the recessed 3' end of the product instead of extending the primer on the template (this is especially a problem as the reaction progresses and is why only 12 or so cycles is recommended).  The blunt-end products won't give you any transformants and also mislead the researcher into thinking their reaction went great because they see a product on a gel, but the product is a dead end.
 +
 +
*For each different mutation at a given position, a new primer pair has to be ordered (mo' money).
 +
 +
'Round-the-horn is a PCR-based mutagenesis.  The muations are contained in one or both of the primers.  The primers are phosphorylated so that the PCR product can be ligated in to a circle and used to transform cells.  The procedure has the advantages that the primers are smaller, a visible product on a gel means your reaction worked and must contain the encoded mutations, only one primer needs to be changed to change the mutation at the same site.
 +
 +
 +
 +
Primer design
Primer design

Revision as of 14:40, 14 September 2005

‘Round the Horn Site-directed mutagenesis

Background

I was in grad school and had to make several amino acid substitutions at the same position in a cloned gene. I came up with this protocol and called it "Around-the-Horn" a phrase used in baseball meaning to throw that ball through all of the base positions. The phrase originally referred to "Rounding Cape Horn of South America" a very difficult, but rewarding journey ("Round-the-horn" is not difficult). Subsequently, a group published a paper describing the process, but I was first and take full credit and have used it in ways not described by others.

I was used to doing "Quick change" (Stratagene) wherein two complementary oligos containing the desired mutation are used to prime extensions all the way around the plasmid. Quickchange is a linear amplification (not PCR) and each round of extensions is performed on the plasmid template. There are several problems and limitations with Quickchange:

  • The Size of the muation is limited to a few base pairs.
  • Each primer has to be long to provide sufficient annealing on both sides of the mutation (money).
  • Non-optimal extension conditions will result in "end-filling" wherein the polymerase fills the recessed 3' end of the product instead of extending the primer on the template (this is especially a problem as the reaction progresses and is why only 12 or so cycles is recommended). The blunt-end products won't give you any transformants and also mislead the researcher into thinking their reaction went great because they see a product on a gel, but the product is a dead end.
  • For each different mutation at a given position, a new primer pair has to be ordered (mo' money).

'Round-the-horn is a PCR-based mutagenesis. The muations are contained in one or both of the primers. The primers are phosphorylated so that the PCR product can be ligated in to a circle and used to transform cells. The procedure has the advantages that the primers are smaller, a visible product on a gel means your reaction worked and must contain the encoded mutations, only one primer needs to be changed to change the mutation at the same site.



Primer design

Forward primer has intended mutation at its 5’ end. Design such that the annealing portion has Tm ~60-63º.

e.g.,

5’-NNNACGTACGTACGTACGTACG-3’

Reverse primer sits on the complementary strand and abuts the site of mutation.


                         NNNACGTACGTACGTACGTACG

…ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT… …TGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA…

      CATGCATGCATGCATGCAT

If the change needed is large, both primers can have mutant 5’ ends. Primers without mutations can be spaced with a gap between them to make deletions.


Primer Phosphorylation

Primer stock at 100 M in water or TE. For each primer:

37 L water 5 L 10 Kinase reaction buffer (comes with PNK) 1 L 50 mM MgSO4 (comes with most polymerases) 5 L primer (10 M final) 1 L 100 mM ATP 1 L PNK 50

37 degrees for 30-60 minutes. Heat each reaction to kill the PNK (65 degrees for 20 minutes, or 95 degrees for 5 min)

PCR Set up on ice. After mixing, put into pre-heated PCR block.

39 L water 5 L 10X polymerase buffer 1.5 L forward primer (0.3 M final) 1.5 L reverse primer 1 L dNTPs (20 mM each) 1 L template (mini-prep’d plasmid) 1 L polymerase (not Taq, use Vent, Deep Vent, 9°N, Pfu) 50 L

PCR program

(1) 95º 1’ (2) 93º 30” (3) 55º 30” (~5º below Tm) (4) 72º 2’ per kb being amplified (5) Goto (2) 27 more times (6) 4º hold

Product Preparation

Run 5 L on a gel. I put EtBr in the gel so I can check to see if there is a product within a few minutes. If you see the band, digest the template in the PCR reactions by adding 1 L of DpnI, mix, and incubate for at least 60 minutes at 37º.

Run a preparative gel of the PCR product, excise the band, and use a kit to extract the product.

Product ligation

2.3 L water* 2 L PCR product 0.5 L 10X ligation buffer 0.2 L ligase 5 L

  • If there is not much product, replace the water fraction with more PCR product.

Incubate over night at room temp.

Transformation

Works best with electroporation or fresh TSS cells. Transform 4 L into 50 L cells. Plate all of it.

Personal tools