'Round-the-horn site-directed mutagenesis
From OpenWetWare
‘Round the Horn Site-directed mutagenesis
Primer design
Forward primer has intended mutation at its 5’ end. Design such that the annealing portion has Tm ~60-63º.
e.g.,
5’-NNNACGTACGTACGTACGTACG-3’
Reverse primer sits on the complementary strand and abuts the site of mutation.
NNNACGTACGTACGTACGTACG
…ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT… …TGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA…
CATGCATGCATGCATGCAT
If the change needed is large, both primers can have mutant 5’ ends. Primers without mutations can be spaced with a gap between them to make deletions.
Primer Phosphorylation
Primer stock at 100 M in water or TE. For each primer:
37 L water 5 L 10 Kinase reaction buffer (comes with PNK) 1 L 50 mM MgSO4 (comes with most polymerases) 5 L primer (10 M final) 1 L 100 mM ATP 1 L PNK 50
37 degrees for 30-60 minutes. Heat each reaction to kill the PNK (65 degrees for 20 minutes, or 95 degrees for 5 min)
PCR Set up on ice. After mixing, put into pre-heated PCR block.
39 L water 5 L 10X polymerase buffer 1.5 L forward primer (0.3 M final) 1.5 L reverse primer 1 L dNTPs (20 mM each) 1 L template (mini-prep’d plasmid) 1 L polymerase (not Taq, use Vent, Deep Vent, 9°N, Pfu) 50 L
PCR program
(1) 95º 1’ (2) 93º 30” (3) 55º 30” (~5º below Tm) (4) 72º 2’ per kb being amplified (5) Goto (2) 27 more times (6) 4º hold
Product Preparation
Run 5 L on a gel. I put EtBr in the gel so I can check to see if there is a product within a few minutes. If you see the band, digest the template in the PCR reactions by adding 1 L of DpnI, mix, and incubate for at least 60 minutes at 37º.
Run a preparative gel of the PCR product, excise the band, and use a kit to extract the product.
Product ligation
2.3 L water* 2 L PCR product 0.5 L 10X ligation buffer 0.2 L ligase 5 L
- If there is not much product, replace the water fraction with more PCR product.
Incubate over night at room temp.
Transformation
Works best with electroporation or fresh TSS cells. Transform 4 L into 50 L cells. Plate all of it.


