20.109(F08): The grafting parlour

From OpenWetWare

Revision as of 14:13, 24 December 2009 by Nkuldell (Talk | contribs)
Jump to: navigation, search
20.109(F08): Laboratory Fundamentals of Biological Engineering

Home        People        Schedule Fall 2008        Assignments        Lab Basics        OWW Basics       
DNA Engineering        Protein Engineering        Biomaterials Engineering              

Contents

NOTES FROM 11.11 meeting with the artist from THE GRAFTING PARLOUR

Please edit and add information that I didn't capture
Nkuldell 16:39, 11 November 2008 (EST)

Initial themes

  • Form brings questions about content
  • Computational approaches represent nature but biology holds in itself the reality of nature
  • Art can tilt and sway perspective
  • Interactive technology (video, telecommunication) are time base media

Framing questions

  • How to look at the world through nature’s point of view?
  • How can artwork change itself during a show?
  • How can artwork change as it travels from gallery to gallery?
  • We value the history of an object but can an object have traces/memories of itself and its history?
  • Is the human desire to “fix time” immutable?
  • We think of our cells as making up us but they have a life of their own as well (circadian pulsing of neurons every 23.5 hours w/o stimulus). What is the biological memory that cells have of a day? What do cells have to say to us?
  • Galleries usually carefully manage light/moisture/temperature to inhibit bacteria growth on art but is this just a romantic notion of art by masters and is the intervention needed? Can unpredictable evolution/passage/change of art be part of art?

Art/Science examples we considered

  • GFP projects from Marc Zimmer: Static images that were not intended as art
  • Hyunkoo Lee: animatus= skeletons from animated characters. Notable for its performance of science, that the artist makes apparent. Some eerie some playful examples.

NOTES: about microscope/display

from Lucy 12.08.08

  • There are ways to convert a webcam into a microscope [1] but my guess is that the magnification is not great.
  • Whether microscope or document camera, it depends on how wide a view will be captured. Here is

one that works with existing analog microscopes: [2]

  • And here is more information on the document camera that I've been looking

at: [3]

G1 to S transition

Primers to check Cln1:GFP and Cln2:GFP strains

Cln1= 1641bp

BLAST2 seq for fwd primer and CLN1
BLAST2 seq for fwd primer and CLN1
BLAST2 seq for rev primer and CLN1+500bp(3')
BLAST2 seq for rev primer and CLN1+500bp(3')

NO270=Forward: CCCT TTTCTCTCTATGCCCAT

  • length = 21
  • Tm = 54.3
  • GC = 47.6

NO271=Reverse: CTAG ATGTTTGTAGGTGGGCA

  • length = 21
  • Tm = 54.3
  • GC = 47.6

PCR product = 977bp
PCR product+GFP = 1690bp



Cln2 = 1638 bp

BLAST2 seq for fwd primer and CLN2
BLAST2 seq for fwd primer and CLN2
BLAST2 seq for rev primer and CLN2+500bp(3')
BLAST2 seq for rev primer and CLN2+500bp(3')

NO272= Forward: CACGGCATATTCTCCATTATC

  • length: 21
  • Tm = 50.9
  • GC = 42.9

NO273= Reverse: GGTCTCTTTTTGGTACGTTTG

  • length = 21
  • Tm = 51.8
  • GC = 42.9

PCR product = 804bp
PCR product+GFP = 1517bp

Additional Primers

NO# Name Seq Length, adds Tm G/C
NO274 CLN1_2GFP_-900fwd CATTAG GCCGGC ACAGCATTC CCTTGTTCGC AACACTT 26, Random NaeI cln1 ~900bp before 63.4 46.2
NO275 CLN1_2GFP_rev CATTAG GGATCC CAGTTGA GAGCTATTGT GGTTCCTTA 26, Random BamHI cln1 63.0 42.3
NO276 CLN2_2GFP_-300forward CATTAG GGTACC GCAGCC TCTGGCTACT TGTTTAACTT 26, Random KpnI cln2 ~300 bp before 63.4 46.2
NO277 CLN2_2GFP_rev CATTAG GGATCC TACTTGGGTA TTGCCCATACCA AAAG 26, Random BamHI cln2 63 42.3
NO278 CLN+GFP_rev CATTAG GCATGC TCACTTGTTCAATAGGCCTATGCCAT 29, Random SphI GFP 63.4 46.2

G2 to M transition

Clb2= 1475bp

  • Reference with Clb2:YFP is here. This reference also includes (as Fig 1) depiction of CFP-TUB1 to label cytoskeleton blue, as well as MYO1-mCherry to label red the contractile ring from cytokinesis.
Personal tools