20.109(S11):Prepare candidate clones in model cell strain (Day5)
From OpenWetWare
Contents |
Introduction
Last time you were here, you transformed your new construct — pED-IPTG-YFD — into XL1-Blue cells. As you can see in the linked manual (PDF), these cells have the following genotype: recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F ́ proAB lacIqZΔM15 Tn10 (Tetr)]. Two gene mutations make XL1-Blue very useful "workhorse" cells for cloning. First, endA1 limits the non-specific destruction of plasmid (and chromosomal) DNA normally carried out by the EndA enzyme, thus maximizing DNA recovery. Second, recA1 makes the cells incapable of homologous recombination, which could otherwise cause undesirable intermingling between the plasmid and chromosomal DNA.
You will extract DNA from three independent colonies that we picked and grew in liquid culture overnight. The procedure you will do is commonly termed "mini-prep," which distinguishes it from a “maxi-” or “large scale-prep” that involves a larger volume of cells and additional steps of purification. The overall goal of each prep is the same--to separate the plasmid DNA from the chromosomal DNA and cellular debris, allowing the plasmid DNA to be studied further. In the traditional mini-prep protocol, the media is removed from the cells by centrifugation. The cells are resuspended in a solution that contains Tris to buffer the cells and EDTA to bind divalent cations in the lipid bilayer, thereby weakening the cell envelope. A solution of sodium hydroxide and sodium dodecyl sulfate (SDS) is then added. The base denatures the cell’s DNA, both chromosomal and plasmid, while the detergent dissolves the cellular proteins and lipids. The pH of the solution is returned to neutral by adding a mixture of acetic acid and potassium acetate. At neutral pH the SDS precipitates from solution, carrying with it the dissolved proteins and lipids. In addition, the DNA strands renature at neutral pH. The chromosomal DNA, which is much longer than the plasmid DNA, renatures as a tangle that gets trapped in the SDS precipitate. The plasmid DNA renatures normally and stays in solution, effectively separating plasmid DNA from the chromosomal DNA and the proteins and lipids of the cell.
Normally in 20.109 we do an in-house mini-prep procedure according to the steps above followed by ethanol precipitation. However, because we are working with a low-copy plasmid, today we will use a commercially available kit to give you the best chance of success. The principle is the same as that of our "quick and dirty" (and cheaper!) prep, but is combined with the silica gel column purification you are familiar with from using other Qiagen kits.
We discussed last time that not all of your colonies may be carrying the correct plasmid, which is why you will isolate three separate clones. The most likely incorrect plasmid is the original pED-IPTG-INS, one that was singly cut (or less likely not cut at all) during the enzymatic digestion. Part of your miniprepped DNA will be sent for sequencing, and you will analyze the results next time to determine a clone to move forward with. In the meantime, you will transform all three candidates clones into the edge detector cell strain, JW3367c.
In order to make our IPTG-sensitive results as comparable as possible to the light-based system, we are using the JW3367c strain even though strictly speaking we don't have to. The genotype of a precursor to this strain can be seen at this link. Of particular importance to the edge detection system are the deletions of native lacZ and envZ, which could otherwise cause background production of black pigment or cross-talk in the 2-component signaling system, respectively. (Recall that the edge detector strain carries a plasmid with Cph8, a fusion of EnvZ and Cph1 that makes the former sensitive to light instead of salt concentration.) The difference between our strain and the linked one is that the envZ deletion is no longer combined with Kanamycin resistance, because KanR is used to mark the phycocyanobilin plasmid instead. Before transforming JW3367c, you will have to make these cells competent to take up foreign DNA by treatment with calcium chloride.
In another week you will finally get to see the results of all your hard work, and know how your modification affected the model system!
Protocols
Part 1: Prepare competent JW3367c cells
- Pick up one 5 mL tube of JW3367c cells. These cells should be in or close to the mid-log phase of growth, which is indicated by an OD600 value of ~ 0.6-1.2 for this strain.
- Measure the OD600 value of a 1:10 dilution of your cells. If the cells are not yet dense enough, return them to the rotary shaker in the incubator. As a rule, your cells should double every 20-30 min.
- Once your cells have reached the appropriate growth phase, pour them into eppendorf tubes. Spin down 3 tubes of ~ 1.5 mL each for 1 min at max speed (~16,000 rcf/13,000 rpm), aspirate the supernatants, and resuspend in an equal volume of ice-cold calcium chloride (100 mM). Note: you can balance these tubes in the centrifuge with three-way symmetry.
- If you are nervous about pouring the liquid, you can use your P1000 to pipet 750 μL into each eppendorf twice. Either way, the eppendorf should be quite full when you try to close the cap. You can wear gloves to keep the bacteria from splashing your skin or you can wash your hands after closing all the caps.
- You may find it easiest to resuspend the cells in a small volume first (say, 200 μL), then add the remaining volume of CaCl2 (e.g., in two steps of 650 μL) and invert the tubes to mix.
- Spin again for 1 min. The resultant pellets may occur as streaks down the side of the eppendorf tube, so be very careful not to disturb the cells when aspirating.
- This strain usually does not streak much, maintaining a relatively compact pellet.
- This time, resuspend each pellet in 100 μL of CaCl2, then pool the cells together in one tube.
- Incubate on ice for 1 hour. (You might work on parts 2, 4, and 5 of today's protocols now, as well as assemble the materials for part 3.)
- Meanwhile, label four eppendorfs and pre-chill them on ice. The labels should indicate a (+) transformation control (the original pED-IPTG-INS), and your three candidate transformations.
Part 2: DNA extraction (mini-prep)
- Pick up your three candidates cultures, growing in the test tubes labeled with your team colour. Label three eppendorf tubes to reflect your candidates (C1-3).
- Vortex the bacteria and pour ~1.5 mL of each candidate into an eppendorf tube.
- Balance the tubes in the microfuge, spin them for two minutes, and remove the supernatants with the vacuum aspirator.
- Pour another 1.5 mL of culture onto the pellet, and repeat the spin step.
- Resuspend the cell pellet in 250 μL buffer P1.
- Buffer P1 contains RNase so that we collect only our nucleic acid of interest, DNA.
- Add 250 μL of buffer P2 and mix by inversion until the suspension is a homogeneous blue colour. About 4-6 inversions of the tube should suffice.
- Buffer P2 contains sodium hydroxide for lysing.
- The blue colour comes from a special reagent that is not required for purification, but is simply used to check one's mixing technique.
- Add 350 μL buffer N3, and mix immediately by inversion until there is no blue colour (4-10 times).
- Buffer N3 contains acetic acid, which will cause the chromosomal DNA to messily precipitate; the faster you invert, the more homogeneous the precipitation will be.
- Buffer N3 also contains a chaotropic salt in preparation for the silica column purification.
- Centrifuge for 10 minutes at maximum speed. Note that you will be saving the supernatant after this step.
- Meanwhile, prepare 3 labeled QIAprep columns, one for each candidate clone.
- Transfer the entire supernatant to the column and centrifuge for 1 min.
- Wash with 0.5 mL PB, then separately with 0.75 mL PE, with each spin step 1 min long.
- After removing the PE, spin the mostly dry column for 1 more min.
- It is important to remove all traces of ethanol, as they may interfere with subsequent work with the DNA.
- Add 30 μL of EB to the top center of the column, wait 1 min, then spin 1 min to collect your DNA.
- EB is elution buffer, or 10 mM TrisCl (pH 8.5).
Part 3: Transform JW3367c with mutant DNA
- Prewarm and dry 4 LB+Amp plates in the 37°C incubator, media side up with the lids ajar.
- When your competent cells are ready, aliquot 70 μL of cells per pre-chilled eppendorf.
- Add 2 μL of the appropriate DNA to each tube.
- The pED-IPTG-INS is at 30 ng/μL.
- If you are uncertain about your miniprep technique, feel free to increase the amount of candidate DNA you use to 5 μL.
- Flick to mix the contents and leave the tubes on ice for at least 5 minutes.
- Continue to heat shock and transform your cells according to the Day 4 Part 3 protocol.
- Briefly: heat shock 90 sec, put on ice 2 min, add 0.5 mL LB, move to 37 °C.
- When you get to the 30 minute incubation step, prepare 3 large glass test tubes each containing 3 mL of LB+Amp, and label them with your team color and sample name. (You can also finish part 5 of the protocol if you have not yet done so.)
- Safety reminder: After dipping the glass spreader in the ethanol jar, then pass it through the flame of the alcohol burner just long enough to ignite the ethanol. After letting the ethanol burn off, the spreader may still be very hot, and it is advisable to tap it gently on a portion of the agar plate without cells in order to equilibrate it with the agar (if it sizzles, it's way too hot).
- Once the plates are done, wrap them with colored tape and put them in the 37°C incubator overnight. One of the teaching faculty will remove them from the incubator and set up liquid cultures for you to use next time.
Part 4: Count colonies
When you have a spare moment today, count the colonies that arose on your transformed XL1-Blue plate, as well as on your positive and negative control plates. Please put your colony counts on today's Talk page.
Part 5: Prepare DNA for Evaluation
Sequencing Reactions
As we will discuss in lab next time, sequencing reactions require a primer for initiation. Legible readout of the gene typically begins about 40-50 bp downstream of the primer site, and continues for ~1000 bp at most. Thus, multiple primers must be used to fully view genes > 1 Kbp in size. Luckily, we only care about a small fragment of pED-IPTG-YFD, i.e., the part containing Plux-λ.
The recommended composition of sequencing reactions is 150-300 ng of plasmid DNA and 3.2 pmoles of sequencing primer in a final volume of 12 μL. The miniprep'd plasmid should have about 20-50 ng of DNA/μL on average.
For each reaction, combine the following reagents in an eppendorf tube:
- 6 μL of your plasmid DNA candidate
- 14 μL of the primer solution on the teaching bench, which (per 14 μL) contains
- 5.3 μL of sequencing primer at 1 pmol/μL
- 8.7 μL sterile water
Mix each solution by pipetting and then transfer 12 μL to an 8-PCR-tube strip. Keep track of which sample is in which tube (A-H), and label your tubes on both the side and the top according to the table below. The teaching faculty will turn in the strips at the Biopolymers Laboratory in the Koch Institute for sequencing.
| Group | Label Range | Group | Label Range |
|---|---|---|---|
| Red | 1-3 | Blue | 13-15 |
| Orange | 4-6 | Pink | 16-18 |
| Yellow | 7-9 | Purple | 19-21 |
| Green | 10-12 |
For next time
- Your Module 1 report revision is due by 11 AM next time, to the 20109.submit address.
- Although you designed DNA oligos in this module, you did not have a chance to design primers. A good resource for checking primers is the company from which we ordered our DNA, IDT. Using the SciTools → OligoAnalyzer at IDT's website, compare and contrast the primer that we used today with the primer sequence GGTTCCGCGCACATTTCCCATGG. Consider the following factors:
- A melting temperature of 55-60 °C and a G/C content of 50-55% is recommended.
- Palindromes should be avoided, particularly at the 3' end. The longer any palindrome is, the worse the primer.
- Sequencing reactions work similarly to PCR. Given your understanding of how DNA strands grow, why is a palindrome at the 3' (vs. 5') end particularly problematic? What product might you get besides a readout of your plasmid DNA?
- One other important factor when designing a primer is ensuring uniqueness. If you were given the entire sequence of pED-IPTG-INS, what computational tool from Module 1 could you use to test if your primer binds to a unique site in the plasmid?
Reagent list
- 100 mM CaCl2
- Qiagen QIAprep miniprep kit
- LB-Amp plates as on Day 4
- Sequencing primer, bp 10517-10538 of pED-IPTG-INS (GCGACACGGAAATGTTGAATAC)


