840:153g:Projects/project1/2008/09/30

From OpenWetWare
Revision as of 19:10, 30 September 2008 by Tiffany J Walters (talk | contribs)
Jump to navigationJump to search
Our Field of Dreams by "Emblazon" <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Our field of Dreams

The mRNA sequence that was used to create the primers was found on GenBank with accession number DQ148458 [1]. This sequence was checked for the restriction sites that would need to be removed by site-directed mutagenesis, so that the gene can be BioBrick compatable. The sequence was analyzed by an website[2] for the restriction site for the 5 restriction enzymes that are the BioBrick standard[3]. There were no restriction sites found within the gene sequence.

The primers were designed from the complementary reverse sequence of the DQ148458. Once the sequence was reversed then we found the location of the start and stop from the Genbank website. The coding region if the sequence is from 208 to 1728 which the primers were designed from these locations. The primer design was done by the program Amplify 1.2 on Dr. James Jurgenson Lab computer at the University if Northern Iowa. The sequence was entered into the program with the forward and reverse sequences of the primers. To make sure that we amplify the gene sequence we reversed the reverse primer sequence. The forward primer is catgtccatcttcctcatcgcaacc and the reverse primer is tcctttcatcaaacaaaccccatacgc. We have named the primers F2mRNA (forward) and R2mRNA (reverse). Then the computer program displayed the output of how much of the sequence will be amplified and the probability of this occurring form a 92% chance of this working in our own lab. Both primers had a primablitiy of 100% which means that they are very likely to amplify this region. The forward primer had a 76% stability match and the reverse primer had a 72% stability. The sequence had a base composition of GC 52.8%. The forward primer had 52% and the reverse primer had 44%. The sequence that was amplified for the gene was 1532 base pairs. The results for the primer design are as shown in figure 1.1 below.

The protocol that we will be using for the RNA extraction is as the manufacture suggested on the company website [4].


Today we repeated the restriction digest of our plasmid DNA using ECOR1 and performed electrophoresis in order to determine if our plasmids contain (roughly) the correct number of base pairs. We encountered some problems with the gel and were unable to determine if our plasmids were in fact, the correct ones, psB1A3 and psB1A7. It looked as if the enzyme may not have worked correctly in digesting the DNA. Axel is going to redo the restriction digest of our plasmid DNA, using less DNA and perform electrophoresis of our samples to see if he can obtain better results. We discussed with Axel our primer design and the protocol that we will be using to added the BioBrick prefix and suffix to our gene. We decided on using PCR to added them instead of trying to using the parts in the registry and doing a blunt end ligation.

For Thursday we will proceed with RNA extraction using the Trizol protocol as listed above with the Orchid Flowers. We will also review the results from the vector. We will also be redesigning the primers to have them add the BioBrick suffix and prefix.

Figure 1.1 [[IMG]http://i84.photobucket.com/albums/k26/snuffbucket/primerdesign2.jpg[/IMG]

Retrieved from "https://openwetware.org/mediawiki/index.php?title=840:153g:Projects/project1/2008/09/30&oldid=247953"