840:153g:Projects/project10/2010/09/30

From OpenWetWare

< 840:153g:Projects | project10 | 2010 | 09(Difference between revisions)
Jump to: navigation, search
(Autocreate 2010/09/30 Entry for 840:153g:Projects/project10)
Current revision (15:46, 7 October 2010) (view source)
 
(3 intermediate revisions not shown.)
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
-
==Entry title==
+
[[Image:[[Image:9_30_10Group10.jpg]]]]==Entry title==
-
* Insert content here...
+
* This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA... it worked! We know it worked because we see DNA on the gel. We also figured out our primers - forward with biobrick extension "Sneezy" GTTTCTTCGAATTCGCGGCCGCTTCTAGCCTTCGTATGTAAGTCGCTG, reverse with biobrick extension "Cowgirl" TACTAGTAGCGGCCGCTGCAGGAAGAAACCGCCGTGCGCGAGTCGCGCG, forward without biobrick extension "Grumpy" CCTTCGTATGTAAGTCGCTG, and reverse without biobrick extension "Cowboy" CGCCGTGCGCGAGTCGCGCG - to be ordered.
 +
Next time we will hopefully receive our primers and run PCR to determine if the primers work.

Current revision

Project name Main project page
Previous entry      Next entry

[[Image:Image:9_30_10Group10.jpg]]==Entry title==

  • This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA... it worked! We know it worked because we see DNA on the gel. We also figured out our primers - forward with biobrick extension "Sneezy" GTTTCTTCGAATTCGCGGCCGCTTCTAGCCTTCGTATGTAAGTCGCTG, reverse with biobrick extension "Cowgirl" TACTAGTAGCGGCCGCTGCAGGAAGAAACCGCCGTGCGCGAGTCGCGCG, forward without biobrick extension "Grumpy" CCTTCGTATGTAAGTCGCTG, and reverse without biobrick extension "Cowboy" CGCCGTGCGCGAGTCGCGCG - to be ordered.

Next time we will hopefully receive our primers and run PCR to determine if the primers work.


Personal tools