
From OpenWetWare

< 840:153g:Projects | project10 | 2010 | 09(Difference between revisions)
Jump to: navigation, search
(Entry title)
Current revision (14:46, 7 October 2010) (view source)
(2 intermediate revisions not shown.)
Line 6: Line 6:
| colspan="2"|
| colspan="2"|
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
==Entry title==
[[Image:[[Image:9_30_10Group10.jpg]]]]==Entry title==
* This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA. We also figured out our primers - forward with biobrick extension, reverse with biobrick extension, forward without biobrick extension, and reverse without biobrick extension - to be ordered.  
* This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA... it worked! We know it worked because we see DNA on the gel. We also figured out our primers - forward with biobrick extension "Sneezy" GTTTCTTCGAATTCGCGGCCGCTTCTAGCCTTCGTATGTAAGTCGCTG, reverse with biobrick extension "Cowgirl" TACTAGTAGCGGCCGCTGCAGGAAGAAACCGCCGTGCGCGAGTCGCGCG, forward without biobrick extension "Grumpy" CCTTCGTATGTAAGTCGCTG, and reverse without biobrick extension "Cowboy" CGCCGTGCGCGAGTCGCGCG - to be ordered.  
Next time we will hopefully receive our primers and run PCR to determine if the primers work.
Next time we will hopefully receive our primers and run PCR to determine if the primers work.

Current revision

Project name Main project page
Previous entry      Next entry

[[Image:Image:9_30_10Group10.jpg]]==Entry title==

  • This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA... it worked! We know it worked because we see DNA on the gel. We also figured out our primers - forward with biobrick extension "Sneezy" GTTTCTTCGAATTCGCGGCCGCTTCTAGCCTTCGTATGTAAGTCGCTG, reverse with biobrick extension "Cowgirl" TACTAGTAGCGGCCGCTGCAGGAAGAAACCGCCGTGCGCGAGTCGCGCG, forward without biobrick extension "Grumpy" CCTTCGTATGTAAGTCGCTG, and reverse without biobrick extension "Cowboy" CGCCGTGCGCGAGTCGCGCG - to be ordered.

Next time we will hopefully receive our primers and run PCR to determine if the primers work.

Personal tools