840:153g:Projects/project19/2011/11/10: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(Autocreate 2011/11/10 Entry for 840:153g:Projects/project19)
 
No edit summary
Line 1: Line 1:
We will be cloning the Cstps1 Gene from Citrus Sinensis.  This gene is responsible for producing an enzyme which reacts with FPP (farnesyl pyrophosphate)to produce valencene, the major component of the citrus scent of oranges.  The gene was located on the Genbank of the NCBI website with the accession number AF441124.1.  The gene contains 1647 bp without introns.  We will design 2 different sets of primers. One set will be compatible with the biobrick ends and the other set will not.  After the gene is cloned, it will be transformed into E. coli, in a select media containing FPP.  If we are able to smell the oranges, our research was successful.  We may also develop another way to test for the scent if it is not evident that it is there right away.
We ran the PCR products from 11/8 on a 1.0% agarose gel.  Again, no DNA appeared to be amplified. Since this result occured with both batches of extracted DNA, the lack of results last time was not the result of that batch (at least not only that batch) being bad. On the other hand, a few small improvements included lack of negative control contamination and selection of proper DNA ladder.   


In order to get past this amplification step, we will need to cut out gel pieces containing amplified DNA fragments.  For that to happen, we need to have amplified DNA. At least one more PCR will need to be done.


Our primers are:
Since multiple trials using 8µL DNA template have produced no results, we will go back to using less DNA. Reactions will be done for both extraction batches using 4µL DNA template. In addition, since we have not attempted to use < 4µL in any PCR so far, we will simultaneously
19_orange1_F: atgtcgtctggagaaacatt
 
19_orange2_R: tcaaaatggaacgtggtctc
 
19_orange1a_F: gaattcgcggccgcttctagatgtcgtctggagaaacatt
 
19_orange2a_R: tactagtagcggccgctgcagtcaaaatggaacgtggtctc
 
   
Our promoters to test are:
BBa_I13453
BBa_I0500
BBa_I765001
 
Accession number to the mRNA of the gene:
AF441124

Revision as of 18:46, 11 November 2011

We ran the PCR products from 11/8 on a 1.0% agarose gel. Again, no DNA appeared to be amplified. Since this result occured with both batches of extracted DNA, the lack of results last time was not the result of that batch (at least not only that batch) being bad. On the other hand, a few small improvements included lack of negative control contamination and selection of proper DNA ladder.

In order to get past this amplification step, we will need to cut out gel pieces containing amplified DNA fragments. For that to happen, we need to have amplified DNA. At least one more PCR will need to be done.

Since multiple trials using 8µL DNA template have produced no results, we will go back to using less DNA. Reactions will be done for both extraction batches using 4µL DNA template. In addition, since we have not attempted to use < 4µL in any PCR so far, we will simultaneously

Retrieved from "https://openwetware.org/mediawiki/index.php?title=840:153g:Projects/project19/2011/11/10&oldid=566008"