840:153g:Projects/project21
From OpenWetWare
| Line 30: | Line 30: | ||
Then we will amplify the DNA using PCR using our BioBrick Primers. We will check for successful amplification by gel electrophoresis. once this is done we will then add our gene to our vector pSB2K3 by using restriction enzymes to digest the two so that they can then be ligated together. then our vector will be inserted into E. coli cells and check for successful insertion of vector by growing E. coli cells on TSA plates with kanamycin. and if this works we plan to attempt to activate the promoter by inducing it with blue light and we will then proceed to test for success by running SDS PAGE (12.06 kD) | Then we will amplify the DNA using PCR using our BioBrick Primers. We will check for successful amplification by gel electrophoresis. once this is done we will then add our gene to our vector pSB2K3 by using restriction enzymes to digest the two so that they can then be ligated together. then our vector will be inserted into E. coli cells and check for successful insertion of vector by growing E. coli cells on TSA plates with kanamycin. and if this works we plan to attempt to activate the promoter by inducing it with blue light and we will then proceed to test for success by running SDS PAGE (12.06 kD) | ||
</p> | </p> | ||
| - | + | BioBrick Primers | |
| + | 21F_Front= 5' gaattcgcggccgcttctagatgggcggtttggtgcatat 3' | ||
| + | 21RP_Back= 5' gtctggttcttcacgagatctactagtagcggccactacag | ||
| + | 3' | ||
| + | BioBrick Promoters: | ||
| + | BBa_K360041[http://partsregistry.org/Part:BBa_K360041] | ||
| + | BBa_I0500[http://partsregistry.org/Part:BBa_I0500] | ||
| + | BBa_K258005[http://partsregistry.org/Part:BBa_K258005] | ||
* Explain your experimental design here | * Explain your experimental design here | ||
* List all the steps that are needed to complete your project | * List all the steps that are needed to complete your project | ||
Revision as of 21:51, 12 September 2012
Customize your entry pages
| |
Team Members
Project Name and DescriptionPMT1149 is produces a Type I antifreeze protein that has been found in the organism Prochlorococcus marinus MIT strain 9313. Antifreeze proteins work in a way such that they are attracted to water molecules or ice and attach to the outside covering the molecule inhibiting further growth and preventing freezing of the cell. If we can successfully clone this gene into E. coli we hope to then find an organism that allows for glycosylation and attempt to test the functionality of the gene. To first test if we can clone PMT1149 into E. coli we will be testing by using SDS PAGE. PMT1149 was found on the NCBI website ([www.ncbi.nlm.nih.gov]) with an accession number of NP_894980 with only 372 bp and no introns due to it coming from a prokaryotic organism. we will be growing Prochlorococcus in the Pro99 medium that was used by the Chisholm's Lab ([1]) and DNA will be extracted using the following protocol [2] Then we will amplify the DNA using PCR using our BioBrick Primers. We will check for successful amplification by gel electrophoresis. once this is done we will then add our gene to our vector pSB2K3 by using restriction enzymes to digest the two so that they can then be ligated together. then our vector will be inserted into E. coli cells and check for successful insertion of vector by growing E. coli cells on TSA plates with kanamycin. and if this works we plan to attempt to activate the promoter by inducing it with blue light and we will then proceed to test for success by running SDS PAGE (12.06 kD) BioBrick Primers 21F_Front= 5' gaattcgcggccgcttctagatgggcggtttggtgcatat 3' 21RP_Back= 5' gtctggttcttcacgagatctactagtagcggccactacag 3' BioBrick Promoters: BBa_K360041[3] BBa_I0500[4] BBa_K258005[5]
Important Results and Milestones
| |
|
Recent changes
| |



