840:153g:Projects/project21

Team Members

• Brandon Ramirez
• Serge Marraback

Project Name and Description

PMT1149 is produces a Type I antifreeze protein that has been found in the organism Prochlorococcus marinus MIT strain 9313. Antifreeze proteins work in a way such that they are attracted to water molecules or ice and attach to the outside covering the molecule inhibiting further growth and preventing freezing of the cell.

If we can successfully clone this gene into E. coli we hope to then find an organism that allows for glycosylation and attempt to test the functionality of the gene. To first test if we can clone PMT1149 into E. coli we will be testing by using SDS PAGE.

PMT1149 was found on the NCBI website ([www.ncbi.nlm.nih.gov]) with an accession number of NP_894980 with only 372 bp and no introns due to it coming from a prokaryotic organism. we will be growing Prochlorococcus in the Pro99 medium that was used by the Chisholm's Lab ([1]) and DNA will be extracted using the following protocol [2]

Then we will amplify the DNA using PCR using our BioBrick Primers. We will check for successful amplification by gel electrophoresis. once this is done we will then add our gene to our vector pSB2K3 by using restriction enzymes to digest the two so that they can then be ligated together. then our vector will be inserted into E. coli cells and check for successful insertion of vector by growing E. coli cells on TSA plates with kanamycin. and if this works we plan to attempt to activate the promoter by inducing it with blue light and we will then proceed to test for success by running SDS PAGE (12.06 kD)

BioBrick Primers:
21F_Front= 5' gaattcgcggccgcttctagatgggcggtttggtgcatat 3'
21RP_Back= 5' gtctggttcttcacgagatctactagtagcggccactacag 3'
BioBrick Promoters:
BBa_K360041[3]
BBa_I0500[4]
BBa_K258005[5]

Project Proposal Presentation:

Important Results and Milestones

• keep track of your most important results and refer to the corresponding page in your notebook
• upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

Recent changes