840:153g:Projects/project24

Team Members

• Name of student Sanju Timilsina
• Name of student Parul Sirohi

Over expression of Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

• Source Organism: E. coli 0157:H7�

PROJECT DESCRIPTION: Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis. TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will clone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do thin layer chromatography for the quantification of fatty acids.

Source: Biology department of University of Northern Iowa� Media: Luria Broth� Gene: Acetyl CoA carboxylase biotin carboxylase (accC)� Assembly #: NC_011353.1 Region: 4242644..4243993� Introns: None because Bacteria does not have any introns. Bio-brick Compatibility: Compatible Plasmid used: Vector Plasmid pSB1A3 Promoter used:Part: BBa_J23100 PCR primers for accC gene Primers:

24F_Biofuel1P 5’gaattcgcggccgcttctagag atgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2S 5’ctgcagactaga cgagttttttctccagatagtggatgttagtgc3’

24F_Biofuel1 5’ atgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2 5’ cgagttttttctccagatagtggatgttagtgc3’

Function of gene: accC is a precursor enzyme which regulates the intermediate bio-synthetic step of Triacyl glycerol production ( fatty acid which is used to produce bio-fuel)

Introduction:The gene of interest in this project is accC ( Acetyl Co-A carboxylase biotin carboxylase).This gene catalyze the formation of malonyl-CoA substrate for biosynthesis of fatty acid synthesis. ACC is a multi subunit( accA, accB, accC and accD) enzyme in most prokaryotes. It is also found in the chloroplast of most of plant and algae. Fatty acid is the major prerequisite for bio-fuel production, so its over production might enhance bio-fuel production. Overexpression of the enzyme DGAT is most likely to enhance lipid, Tri-acylglycerol over production but due to high introns numbers in the source ( Arabidopsis thaliana) we chose ACC over DGAT

3 major biochemical steps:

1. Carboxylation of acetyl- CoA to form malonyl CoA by enzyme ACC which has four sub-unit (accA,accB,accC and accD) 2.Acyl chain elongation 3.TAG formation.

• [[Steps for project:]]

1.Grow the source organism (E. coli) 2.DNA extraction from the source (E. coli) 3.Electrophoresis to check desired DNA segment (bp) 4.Primer designing 5.Multiplication of gene of interest by PCR 6.Electrophorosis 7.Digestion of Plasmid by restriction enzymes ( cut plasmid with S+P i.e bp2 and gene of interest with X+P i.e bp 2149 and P at bp20 ) 8.Ligation of accC gene in plasmid vector (pSB1A3) 9.Transformation of vector plasmid into host organism E. coli 10.Cloning of cells in a LB media 11.Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin) 12.Inoculation of E.coli in biomass 13.Testing of fatty acid by High pressure thin layer chromatography

• Do not go into experimental details and don't list procedures. Just list the major steps necessary to complete your project
• Please also make yourself familiar with uploading pictures and *.ppt files

Important Results and Milestones

• keep track of your most important results and refer to the corresponding page in your notebook
• upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

Recent changes