840:153g:Projects/project24

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 19: Line 19:
==Over expression of ''E. coli'' Acetyl- CoA carboxylase (ACC)sub-unit accC in ''E.coli'' to enhance fatty acid accumulation for Bio-fuel production”.==
==Over expression of ''E. coli'' Acetyl- CoA carboxylase (ACC)sub-unit accC in ''E.coli'' to enhance fatty acid accumulation for Bio-fuel production”.==
* Source Organism:'' E. coli'' 0157:H7�
* Source Organism:'' E. coli'' 0157:H7�
 +
'''PROJECT DESCRIPTION'''
'''PROJECT DESCRIPTION'''
-
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis. TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.   
+
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.   
 +
 
 +
 
'''Source:''' Biology department of University of Northern Iowa�
'''Source:''' Biology department of University of Northern Iowa�
 +
'''Media:''' Luria Broth�
'''Media:''' Luria Broth�
 +
 +
'''Gene:''' Acetyl CoA carboxylase biotin carboxylase (accC)�
'''Gene:''' Acetyl CoA carboxylase biotin carboxylase (accC)�
 +
 +
'''Accession #:''' NC_011353.1 Region: 4242644..4243993 total base pair- 1350�
'''Accession #:''' NC_011353.1 Region: 4242644..4243993 total base pair- 1350�
 +
 +
'''Introns''': None because Bacteria does not have any introns.
'''Introns''': None because Bacteria does not have any introns.
 +
 +
'''Bio-brick Compatibility:''' Compatible
'''Bio-brick Compatibility:''' Compatible
 +
 +
'''Plasmid used''': Vector Plasmid pSB1A3
'''Plasmid used''': Vector Plasmid pSB1A3
 +
 +
'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc
'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Revision as of 13:33, 12 September 2012

Insert non-formatted text here{|border="1" cellpadding="4" cellspacing="0" style="border:#c9c9c9 1px solid; margin: 1em 1em 1em 0; border-collapse: collapse;" width="800" |-<nowiki>Insert non-formatted text here</nowiki> |style="background-color: #cdde95;" align="center"|

|align="center" style="background-color: #e5edc8;" |

Search this Project

|- |colspan="2" style="background-color: #F2F2F2;" align="right"|Customize your entry pages |- |colspan="2"|

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7�

PROJECT DESCRIPTION Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.


Source: Biology department of University of Northern Iowa�

Media: Luria Broth�


Gene: Acetyl CoA carboxylase biotin carboxylase (accC)�


Accession #: NC_011353.1 Region: 4242644..4243993 total base pair- 1350�


Introns: None because Bacteria does not have any introns.


Bio-brick Compatibility: Compatible


Plasmid used: Vector Plasmid pSB1A3


Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc


Alternative Promoters: BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.


J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)


PCR primers for accC gene

• 24F_Biofuel1P 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’


• 24RP_Biofuel2S 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’


• 24F_Biofuel1 5’ atgctggataaaattgttattgccaaccgc 3’


• 24RP_Biofuel2 5’ cgagttttttctccagatagtggatgttagtgc3’


• [[Steps for project:]]


• Grow the source organism (E. coli)


• DNA extraction from the source (E. coli)


• Electrophoresis to check desired DNA segment (bp)


• Primer designing


• Multiplication of gene of interest by PCR


• Electrophorosis


• Digestion of Plasmid and gene by restriction enzymes


• Ligation of accC gene in plasmid vector (pSB1A3)


• Transformation of vector plasmid into host organism E. coli


• Cloning of cells in a LB media


• Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)


• Inoculation of E.coli in biomass


• Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography


Presentation:Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx‎ (file size: 472 KB, MIME type: application/zip)


References:


• Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522


• Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41


http://partsregistry.org/Main_Page


http://www.ncbi.nlm.nih.gov/


http://scholar.google.com/


Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

|- |colspan="2" style="background-color: #F2F2F2;"| Recent changes


|}



Personal tools