840:153g:Projects/project24
From OpenWetWare
(Difference between revisions)
m |
|||
| (46 intermediate revisions not shown.) | |||
| Line 14: | Line 14: | ||
|colspan="2"| | |colspan="2"| | ||
==Team Members== | ==Team Members== | ||
| - | * | + | * Sanju Timilsina |
| - | * | + | * Parul Sirohi |
| - | ==Over expression of Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.== | + | ==Over expression of ''E. coli'' Acetyl- CoA carboxylase (ACC)sub-unit accC in ''E.coli'' to enhance fatty acid accumulation for Bio-fuel production”.== |
| - | * Source Organism: E. coli 0157: | + | * Source Organism:'' E. coli'' 0157:H7 |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| + | =='''Project Description'''== | ||
| + | Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids. | ||
| - | + | =='''Overview'''== | |
| - | + | *'''Source:''' Biology department of University of Northern Iowa | |
| + | *'''Media:''' Luria Broth | ||
| + | *'''Gene:''' Acetyl CoA carboxylase biotin carboxylase (accC) | ||
| + | *'''Accession no.:''' NC_011353.1 Region: 4242644..4243993 total base pair- 1350 | ||
| + | *'''Introns''': None because Bacteria does not have any introns. | ||
| + | *'''Bio-brick Compatibility:''' Compatible | ||
| + | *'''Plasmid used''': Vector Plasmid pSB1A3 | ||
| + | *'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc | ||
| - | + | ==Alternative Promoters:== | |
| - | + | *'''BBa-K206000(PBad)''': is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC. | |
| + | *'''J23109:RFP-106''' tttacagctagctcagtcctagggactgtgctagc (is medium promoter) | ||
| - | + | =='''PCR primers for accC gene'''== | |
| + | *• 24F_Biofuel1P -- 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’ | ||
| + | *• 24RP_Biofuel2S -- 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’ | ||
| - | + | *• 24F_Biofuel1 -- 5’ atgctggataaaattgttattgccaaccgc 3’ | |
| - | + | *• 24RP_Biofuel2 -- 5’ cgagttttttctccagatagtggatgttagtgc3’ | |
| - | ''' | + | =='''Steps for project'''== |
| - | + | *• Grow the source organism (E. coli) | |
| - | + | *• DNA extraction from the source (E. coli) | |
| - | + | *• Electrophoresis to check desired DNA segment (bp) | |
| + | *• Primer designing | ||
| + | *• Multiplication of gene of interest by PCR | ||
| + | *• Electrophorosis | ||
| + | *• Digestion of Plasmid and gene by restriction enzymes | ||
| + | *• Ligation of accC gene in plasmid vector (pSB1A3) | ||
| + | *• Transformation of vector plasmid into host organism E. coli | ||
| + | *• Cloning of cells in a LB media | ||
| + | *• Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin) | ||
| + | *• Inoculation of E.coli in biomass | ||
| + | *• Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography | ||
| - | |||
| - | + | ||
| - | + | =='''References'''== | |
| - | + | *• Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522 | |
| + | *http://mmbr.asm.org/content/57/3/522.full.pdf+html | ||
| + | *• Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41 | ||
| + | *http://www.sciencedirect.com/science/article/pii/S0168165609000959 | ||
| + | *• Siaut, M., Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117 | ||
| + | *http://www.biomedcentral.com/1472-6750/11/7 | ||
| - | + | ==''''''Presentation'''''':== | |
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| - | + | ||
| + | *Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file) <br> | ||
| + | *http://openwetware.org/images/4/42/Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx | ||
| + | |||
==Important Results and Milestones== | ==Important Results and Milestones== | ||
* keep track of your most important results and refer to the corresponding page in your notebook | * keep track of your most important results and refer to the corresponding page in your notebook | ||
Revision as of 14:25, 18 September 2012
Customize your entry pages
| |
Team Members
Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.
Project DescriptionOur gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids. Overview
Alternative Promoters:
PCR primers for accC gene
Steps for project
References
'Presentation':
Important Results and Milestones
| |
|
Recent changes
| |



