840:153g:Projects/project24
From OpenWetWare
< 840:153g:Projects(Difference between revisions)
Current revision (20:18, 6 December 2012) (view source) |
|||
| (23 intermediate revisions not shown.) | |||
| Line 1: | Line 1: | ||
| - | + | {|{{table}} width="800" | |
| - | |- | + | |- |
|style="background-color: #cdde95;" align="center"| | |style="background-color: #cdde95;" align="center"| | ||
<!-- ## START calendar column --> | <!-- ## START calendar column --> | ||
| Line 20: | Line 20: | ||
* Source Organism:'' E. coli'' 0157:H7 | * Source Organism:'' E. coli'' 0157:H7 | ||
| - | ''' | + | =='''Project Description'''== |
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids. | Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids. | ||
| - | + | =='''Overview'''== | |
*'''Source:''' Biology department of University of Northern Iowa | *'''Source:''' Biology department of University of Northern Iowa | ||
*'''Media:''' Luria Broth | *'''Media:''' Luria Broth | ||
| Line 33: | Line 33: | ||
*'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc | *'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc | ||
| - | + | ==Alternative Promoters:== | |
*'''BBa-K206000(PBad)''': is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC. | *'''BBa-K206000(PBad)''': is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC. | ||
*'''J23109:RFP-106''' tttacagctagctcagtcctagggactgtgctagc (is medium promoter) | *'''J23109:RFP-106''' tttacagctagctcagtcctagggactgtgctagc (is medium promoter) | ||
| - | '''PCR primers for accC gene''' | + | =='''PCR primers for accC gene'''== |
| - | *• 24F_Biofuel1P | + | *• 24F_Biofuel1P -- 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’ |
| - | *• 24RP_Biofuel2S | + | *• 24RP_Biofuel2S -- 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’ |
| - | *• 24F_Biofuel1 | + | *• 24F_Biofuel1 -- 5’ atgctggataaaattgttattgccaaccgc 3’ |
| - | *• 24RP_Biofuel2 | + | *• 24RP_Biofuel2 -- 5’ cgagttttttctccagatagtggatgttagtgc3’ |
| - | + | =='''Steps for project'''== | |
*• Grow the source organism (E. coli) | *• Grow the source organism (E. coli) | ||
*• DNA extraction from the source (E. coli) | *• DNA extraction from the source (E. coli) | ||
| Line 62: | Line 62: | ||
| - | + | =='''References'''== | |
*• Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522 | *• Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522 | ||
| + | *http://mmbr.asm.org/content/57/3/522.full.pdf+html | ||
*• Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41 | *• Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41 | ||
| - | * | + | *http://www.sciencedirect.com/science/article/pii/S0168165609000959 |
| - | *• | + | *• Siaut, M., Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117 |
| - | * | + | *http://www.biomedcentral.com/1472-6750/11/7 |
| + | |||
| + | ==''''''Presentation'''''':== | ||
| - | + | *Fuel_it_up_FINAL_Slide_Copy_PROJECT PROPOSAL .pptx (file) <br> | |
| + | *http://openwetware.org/images/4/42/Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx | ||
| - | + | *Fuel it up Final Project presentation | |
| - | http://openwetware.org/ | + | * http://openwetware.org/wiki/Image:Group_25_final_presentation.pptx |
==Important Results and Milestones== | ==Important Results and Milestones== | ||
Current revision
Customize your entry pages
| |
Team Members
Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.
Project DescriptionOur gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids. Overview
Alternative Promoters:
PCR primers for accC gene
Steps for project
References
'Presentation':
Important Results and Milestones
| |
|
Recent changes
| |



