
From OpenWetWare

< 840:153g:Projects(Difference between revisions)
Jump to: navigation, search
Current revision (20:18, 6 December 2012) (view source)
(3 intermediate revisions not shown.)
Line 1: Line 1:
<nowiki>Insert non-formatted text here</nowiki>{|{{table}} width="800"
{|{{table}} width="800"
|-<nowiki><nowiki>Insert non-formatted text here</nowiki></nowiki>
|style="background-color: #cdde95;" align="center"|
|style="background-color: #cdde95;" align="center"|
<!-- ## START calendar column -->
<!-- ## START calendar column -->
Line 72: Line 72:
*Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file) <br>
*Fuel_it_up_FINAL_Slide_Copy_PROJECT PROPOSAL .pptx (file) <br>
*Fuel it up Final Project presentation
* http://openwetware.org/wiki/Image:Group_25_final_presentation.pptx                                       
==Important Results and Milestones==
==Important Results and Milestones==

Current revision

Search this Project

Customize your entry pages

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7

Project Description

Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.


  • Source: Biology department of University of Northern Iowa
  • Media: Luria Broth
  • Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
  • Accession no.: NC_011353.1 Region: 4242644..4243993 total base pair- 1350
  • Introns: None because Bacteria does not have any introns.
  • Bio-brick Compatibility: Compatible
  • Plasmid used: Vector Plasmid pSB1A3
  • Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Alternative Promoters:

  • BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
  • J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)

PCR primers for accC gene

  • • 24F_Biofuel1P -- 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2S -- 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  • • 24F_Biofuel1 -- 5’ atgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2 -- 5’ cgagttttttctccagatagtggatgttagtgc3’

Steps for project

  • • Grow the source organism (E. coli)
  • • DNA extraction from the source (E. coli)
  • • Electrophoresis to check desired DNA segment (bp)
  • • Primer designing
  • • Multiplication of gene of interest by PCR
  • • Electrophorosis
  • • Digestion of Plasmid and gene by restriction enzymes
  • • Ligation of accC gene in plasmid vector (pSB1A3)
  • • Transformation of vector plasmid into host organism E. coli
  • • Cloning of cells in a LB media
  • • Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
  • • Inoculation of E.coli in biomass
  • • Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography


  • • Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522
  • http://mmbr.asm.org/content/57/3/522.full.pdf+html
  • • Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
  • http://www.sciencedirect.com/science/article/pii/S0168165609000959
  • • Siaut, M., Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
  • http://www.biomedcentral.com/1472-6750/11/7


Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

Recent changes

Personal tools