840:153g:Projects/project24

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 43: Line 43:
24RP_Biofuel2  5’ cgagttttttctccagatagtggatgttagtgc3’
24RP_Biofuel2  5’ cgagttttttctccagatagtggatgttagtgc3’
-
                       
+
Presentation:Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx‎ (file size: 472 KB, MIME type: application/zip)                       
    
    

Revision as of 13:19, 11 September 2012

Search this Project

Customize your entry pages

Team Members

  • Name of student Sanju Timilsina
  • Name of student Parul Sirohi

Over expression of Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7�

PROJECT DESCRIPTION: Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis. TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will clone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do thin layer chromatography for the quantification of fatty acids.

Source: Biology department of University of Northern Iowa� Media: Luria Broth� Gene: Acetyl CoA carboxylase biotin carboxylase (accC)� Accession #: NC_011353.1 Region: 4242644..4243993 total base pair- 1350� Introns: None because Bacteria does not have any introns. Bio-brick Compatibility: Compatible Plasmid used: Vector Plasmid pSB1A3 Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Alternative Promoters: J23113:RFP- 21 ctgatggctagctcagtcctagggattatgctagc J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc

PCR primers for accC gene

24F_Biofuel1P 5’gaattcgcggccgcttctagag atgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2S 5’ctgcagactaga cgagttttttctccagatagtggatgttagtgc3’

24F_Biofuel1 5’ atgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2 5’ cgagttttttctccagatagtggatgttagtgc3’

Presentation:Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx‎ (file size: 472 KB, MIME type: application/zip)                        


  • [[Steps for project:]]

1.Grow the source organism (E. coli) 2.DNA extraction from the source (E. coli) 3.Electrophoresis to check desired DNA segment (bp) 4.Primer designing 5.Multiplication of gene of interest by PCR 6.Electrophorosis 7.Digestion of Plasmid by restriction enzymes ( cut plasmid with S+P i.e bp2 and gene of interest with X+P i.e bp 2149 and P at bp20 ) 8.Ligation of accC gene in plasmid vector (pSB1A3) 9.Transformation of vector plasmid into host organism E. coli 10.Cloning of cells in a LB media 11.Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin) 12.Inoculation of E.coli in biomass 13.Testing of fatty acid by High pressure thin layer chromatography

  • Do not go into experimental details and don't list procedures. Just list the major steps necessary to complete your project
  • Please also make yourself familiar with uploading pictures and *.ppt files

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

Recent changes




Personal tools