840:153g:Projects/project24
From OpenWetWare
| Line 60: | Line 60: | ||
'''Presentation''':Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file size: 472 KB, MIME type: application/zip) | '''Presentation''':Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file size: 472 KB, MIME type: application/zip) | ||
| - | '''References: | + | '''References: Magnuson, K., Jackowski, S. Rock,C.O., and Cronan, J.E.1993.Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522 |
| + | |||
| + | Noemie Manuelle Dorval Courchesne, Albert Parisien, Bei Wang, Christopher Q. lan 2009 Enhancement of lipid production using biochemical, genetic and transcription factor engineering approches, Journal of botechnology | ||
| + | http://partsregistry.org/Main_Page | ||
| + | http://www.ncbi.nlm.nih.gov/ | ||
| + | http://scholar.google.com/ | ||
| + | |||
==Important Results and Milestones== | ==Important Results and Milestones== | ||
* keep track of your most important results and refer to the corresponding page in your notebook | * keep track of your most important results and refer to the corresponding page in your notebook | ||
Revision as of 20:46, 11 September 2012
Customize your entry pages
| |
Team Members
Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.
PROJECT DESCRIPTION Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis. TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids. Source: Biology department of University of Northern Iowa� Media: Luria Broth� Gene: Acetyl CoA carboxylase biotin carboxylase (accC)� Accession #: NC_011353.1 Region: 4242644..4243993 total base pair- 1350� Introns: None because Bacteria does not have any introns. Bio-brick Compatibility: Compatible Plasmid used: Vector Plasmid pSB1A3 Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc Alternative Promoters: BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC. J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter) PCR primers for accC gene 24F_Biofuel1P 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2S 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’ 24F_Biofuel1 5’ atgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2 5’ cgagttttttctccagatagtggatgttagtgc3’
1.Grow the source organism (E. coli) 2.DNA extraction from the source (E. coli) 3.Electrophoresis to check desired DNA segment (bp) 4.Primer designing 5.Multiplication of gene of interest by PCR 6.Electrophorosis 7.Digestion of Plasmid and gene by restriction enzymes 8.Ligation of accC gene in plasmid vector (pSB1A3) 9.Transformation of vector plasmid into host organism E. coli 10.Cloning of cells in a LB media 11.Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin) 12.Inoculation of E.coli in biomass 13.Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography Presentation:Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file size: 472 KB, MIME type: application/zip) References: Magnuson, K., Jackowski, S. Rock,C.O., and Cronan, J.E.1993.Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522 Noemie Manuelle Dorval Courchesne, Albert Parisien, Bei Wang, Christopher Q. lan 2009 Enhancement of lipid production using biochemical, genetic and transcription factor engineering approches, Journal of botechnology http://partsregistry.org/Main_Page http://www.ncbi.nlm.nih.gov/ http://scholar.google.com/ Important Results and Milestones
| |
|
Recent changes
| |



