840:153g:Projects/project25
From OpenWetWare
Current revision (21:42, 4 December 2012) (view source) |
|||
| (One intermediate revision not shown.) | |||
| Line 52: | Line 52: | ||
* Grow E. coli bacteria on experimental plates (No ampicillin, ampicillin, and ampicillin + L-arabinose) | * Grow E. coli bacteria on experimental plates (No ampicillin, ampicillin, and ampicillin + L-arabinose) | ||
* Verification testing by examining the physical cell shapes under a light microscope and sequence verification by sending a sample of cloned DNA to Iowa State. | * Verification testing by examining the physical cell shapes under a light microscope and sequence verification by sending a sample of cloned DNA to Iowa State. | ||
| + | |||
| + | == Results & Conclusions == | ||
| + | ''To see our full results and conclusions presentation:'' [[http://openwetware.org/wiki/Image:FINAL_RecombPPT.pdf]] | ||
==References== | ==References== | ||
Current revision
Customize your entry pages
| |
Team Tango Alpha
Cloning of mreB from Caulobacter crescentus into E. coliTo see our full project description see initial project presentation: [[1]] The goal of our project is to clone the gene, mreB, from Caulobacter crescentus (stalked shaped cell) into Escherchia coli (rod shaped cell) to see if mreB will affect E. coli's cell shape in some way. We expect to see the E. coli cells lyse or change from their normal rod shape. Normal E. coli cell shape [[2]] Normal C. crescentus cell shape [[3]] Lysed E. coli cells [[4]] Abnormal E. coli cells [[5]], [[6]] MreB is a rod-shape determining gene that appears as bands or spirals encircling the cell. It is known to associate with mreC and penicillin-binding proteins to catalyze precursors for the peptidoglycan cell wall and correctly position polar bacterial proteins. It is also homologous of actin in eukaryotes. Parts
Forward Primer: 5' ATGTTCTCTTCCCTTTTCGGCGTGATCTCGAACG 3' Reverse Primer: 5' CTAGGCCAGCGTGGATTCCA 3'
Procedure
Results & ConclusionsTo see our full results and conclusions presentation: [[10]] ReferencesGitai, Z., & Yakhnina, A.A. (2012). The small protein mbiA interacts with mreB and modulates cell shape in caulobacter crescentus. Molecular Microbiology. doi: 10.1111/j.1365-2958.2012.08159.x [11] Jacobs-Wagner, C., et al. (2012). Osmolality dependent relocation of penicillin-binding protein PBP2 to the division site in caulobacter crescentus. Journal of Bacteriology. doi: 10.1128 [12]
| |
|
Recent changes
| |



