AU Biomaterials Design Lab:Materials/ADA Gene

From OpenWetWare

< AU Biomaterials Design Lab:Materials(Difference between revisions)
Jump to: navigation, search

Abigail E. Miller (Talk | contribs)
(New page: == Gene Sequence== The Adenosine Deaminase Sequence from [http://www.addgene.org/25576/ addGene, Plasmid 25576: Py-ADA] GAAATAAAGTTCCTCAAAAAGGAAGATGTACAAAACATCGATTTAAACGGAATGAGTAAAAAAGAA...)
Next diff →

Current revision

Gene Sequence

The Adenosine Deaminase Sequence from addGene, Plasmid 25576: Py-ADA

GAAATAAAGTTCCTCAAAAAGGAAGATGTACAAAACATCGATTTAAACGGAATGAGTAAAAAAGAAAGAT ATGAAATATGGAGAAGAATTCCCAAAGTTGAATTACATTGCCATTTAGATTTAACATTTTCTGCTGAATT TTTTTTAAAATGGGCTCGAAAATATAATCTACAACCTAACATGTCAGATGACGAAATACTTGATCATTAT TTATTTACAAAAGAAGGAAAATCATTAGCAGAATTTATTAGAAAAGCAATAAGTGTTTCTGATTTATATA GAGATTATGATTTTATTGAAGATTTGGCCAAATGGGCAGTTATTGAAAAATATAAAGAAGGTGTTGTTTT AATGGAATTTCGATATTCACCAACTTTTGTTTCTTCATCTTATGGATTAGATGTAGAATTGATTCATAAA GCATTTATAAAAGGAATAAAAAATGCTACAGAATTATTAAACAATAAAATACATGTTGCATTAATATGTA TTAGTGATACTGGACATGCTGCTGCTAGTATTAAACATTCTGGAGATTTTGCAATTAAACATAAACATGA TTTCGTTGGTTTTGATCATGGTGGACGTGAAATAGATTTAAAAGATCATAAAGATGTATATCATTCAGTT AGGGATCATGGTTTACATCTAACTGTACATGCAGGTGAAGATGCAACTTTACCAAATCTAAATACTTTAT ATACTGCTATCAATATTTTAAATGTTGAACGTATTGGTCATGGTATAAGAGTTTCAGAATCAGATGAACT AATTGAATTAGTTAAAAAAAAAGATATCTTATTAGAAGTATGCCCAATATCTAATCTTTTATTAAATAAT GTTAAATCTATGGATACACATCCAATTAGAAAATTATATGATGCTGGTGTTAAAGTATCTGTTAATTCCG ATGATCCTGGAATGTTTTTATCAAACATAAATGATAATTACGAAAAATTATATATCCATCTAAATTTTAC ATTAGAAGAATTTATGATTATGAATAACTGGGCTTTTGAAAAATCTTTCGTTAGTGACGATGTTAAAAGC GAGCTTAAAGCGTTGTACTTT

Personal tools