Arking:JCAOligoTutorial1

Introduction To Oligo Design

This tutorial takes you through the basics of how to design oligos to clone a gene and insert it into a plasmid. At the end of the process, you will have a construction file that describes how all the bits and pieces will be put together, and the sequences of the oligonucleotides you need to order to do your experiment. To do this, you'll need the sequence of the gene you want to clone, the sequence of the plasmid you want to put it in, and a program such as ~ApE to manipulate the sequence.

The Construction File

To get started, let's look at a complete construction file:

 Construction of KanR Basic Part Bca9128
 PCR ca1067F/R on pSB1AK3-b0015           (1055bp, EcoRI/SpeI/DpnI)
 Sub into pSB1A2-I13521                   (EcoRI/SpeI, 2602+946, L)
 Product is pSB1A2-Bca9128  [KanR]
 -------------------------------------
 ca1067F  Forward Biobricking of KanR of pSB1AK3  ccagtGAATTCgtccTCTAGAgagctgatccttcaactc
 ca1067R  Reverse Biobricking of KanR of pSB1AK3  gcagtACTAGTtccgtcaagtcagcgtaatg

This is an example of cloning the gene kanR encoding the kanamycin resistance gene from a plasmid and inserting it into the Biobrick plasmid pSB1A2-I13521. The product of the experiment is plasmid pSB1A2-Bca9128. The template for the PCR is SB1AK3-b0015. You can view the sequences for these plasmids by saving the text in these files to your computer.

The format you're seeing is the common GenBank format. Many programs including ApE (A plasmid Editor) can interpret this format and perform the operations described in this tutorial (locating restriction sites and reverse complementing sequences). If you are unable to download a suitable program, these functions can also be performed with the tools at http://searchlauncher.bcm.tmc.edu/seq-util/seq-util.html

What the construction file is saying to do is set up a PCR reaction with oligonucleotides ca1067F and ca1067R using pSB1A2-I13521 plasmid DNA as template for the reaction. The product of that PCR reaction is 1055 bp, and you should digest it with ~EcoRI, SpeI, and DpnI restriction enzymes. You would in parallel set up a digest of plasmid pSB1A2-I113521 with EcoRI and SpeI which will cut the plasmid into two fragments of sizes 2602 and 946 bp. The "L" means you want to gel purify the large fragment. Upon ligating this fragment to your PCR digest, you will transform and the product of cloning is plasmid pSB1A2-Bca9128.

To understand this further, let's focus on the oligos and template and how they work.

Interpreting the Construction File

Let's look at the oligos and see what's in them:

 ca1067F  Forward Biobricking of KanR of pSB1AK3  ccagtGAATTCgtccTCTAGAgagctgatccttcaactc
 ca1067R  Reverse Biobricking of KanR of pSB1AK3  gcagtACTAGTtccgtcaagtcagcgtaatg

The first part is the name of the oligo, the second part is a description of what it's for, and the third part is the sequence of the oligo in 5' to 3' format. Keep in mind that oligonucleotides are single stranded DNAs, and the direction of the oligo is very important. In general, the restriction sites will always appear on the 5' end of the oligo (the left-hand side). Here, the EcoRI (GAATTC), XbaI (TCTAGA), and SpeI (ACTAGT) restriction sites are shown in upper case letters. When ordering oligos from most suppliers (IDT and Genosys included) the case of the letters is irrelevent. It is useful to change the case to highlight special features in your sequences such as restriction sites.

When you run a PCR, you are annealing the oligos to the template sequence and initiating polymerization. Polymerization always goes in the 5' to 3' direction. What this means is that the chain initiates from the 3' end of the oligo (the righthand side). The polymerases have a fairly strict requirement that the last 6 bases of the oligo need to base pair with the template for the reaction to occur. In the case of ca1067F, that would be the sequence caactc. However, the melting temperature, or Tm of this sequence alone is only -10.5 degrees Celsius. Your PCR will be operating at no temperature lower than 45 degrees, so a sequence this short would be dissociated from its template under all conditions experienced during the reaction. Therefore, the oligo must have signficantly more homology to the template than this. Usually the "annealing region" of the oligo is bare minimum 15 bp, but typically more like 20 bp. For oligo ca1067, the annealing region is the sequence gagctgatccttcaactc.

To see how this works, open up pSB1AK3-b0015 in an editor and search for gagctgatccttcaactc. You should see the sequence light up just upstream of the KanR gene.

Now try search for the entire oligo sequence ccagtGAATTCgtccTCTAGAgagctgatccttcaactc in pSB1AK3-b0015. It fails! Why? Only the annealing region of this oligo matches the template and here lies an important principle about oligo design. Only the 3' annealing region of the oligo has to match the template for PCR to work. You can pin almost any sequence to the 5' end of the oligo, and that sequence will be incorporated into the final PCR product. Here, we are using this to incorporate restriction sites into the PCR product. Note, though, that additional sequence lies in between the two restriction sites, and 5 bp of arbitrary sequence lies on the 5' end of the oligo. The reason for additing these bases is that restriction enzymes don't like to cut their sequence when there is nothing upstream of the sequence. Each enzyme is different, but in general pinning 5 bases on the end of an oligo is sufficient for most enzymes. For a more detailed description of this issue on a case-by-case basis, you can check out this http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_olignucleotides.asp

Alright, so now let's predict the product of PCR with oligos ca1067F and ca1067R on pSB1AK3-b0015.

Predicting the PCR Product

Select the annealing sequence of ca1067F (gagctgatccttcaactc) and search for it again. Now copy the entire sequence of the oligo (ccagtGAATTCgtccTCTAGAgagctgatccttcaactc) and while the annealing region is still highlighted within the file, paste the copied text to replace the annealing sequence with the oligo sequence. Now select all the sequence upstream (to the left) of your oligo sequence and delete it. You have now "fixed" the 5' end of your PCR product.

Now, let's look at the 3' end of your PCR product. First of all, grab the annealing region of ca1067R (tccgtcaagtcagcgtaatg). Do a find for this sequence in your ApE file. It should fail. Why? The reverse oligo anneals to the other strand of the template DNA. This will always be the case. One of your two oligos will match the template exactly, the other will only match as the reverse complement. So, you need to first reverse complement the sequence of ca1067R. Use your program to reverse complement the sequence and copy it to the clipboard. Paste the sequence into a new window. It should be cattacgctgacttgacggaACTAGTactgc. Note that now the ~SpeI restriction site is on the right-hand side of the sequence, and the annealing region is on the left-most side.

Now grab the annealing region of this sequence (cattacgctgacttgacgg) and search for it in the pSB1AK3-b0015 file. Note there is an extra "a" in between the annealing region and the template here. The exact annealing region can sometimes be a little hard to pinpoint in this business, but you can always start with the terminus of the oligo and work your way over. Say, start with the first 10 bp (cattacgctg) and search for that, and if that's not a unique string in your template, search for the first 12 or 15 bases. Again, replace the annealing region with the complete sequence of the reverse-complemented oligo. Now, find the right-most end of the oligo and delete everything downstream of it. You should now have the sequence:

 ccagtGAATTCgtccTCTAGAgagctgatccttcaactcagcaaaagttcgatttattcaacaaagccacgttgtgtctcaaaatctctgatgttacattgcacaagataaaaatatatcatcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagccatattcaacgggaaacgtcttgctccaggccgcgattaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcctcttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcgatccccgggaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtccttttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttggttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaagaaatgcataagcttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaattgcagtttcatttgatgctcgatgagtttttctaatcagaattggttaattggttgtaacactggcagagcattacgctgacttgacggaACTAGTactgc

This is the sequence of your PCR product. If it doesn't match this, go back and try this again. You need to be confident in your ability to predict the PCR product given template and oligo sequences. It's critical to be able to design PCR reactions that will produce the product you need for your experiment. Eventually, this tutorial will get you to design the oligos for a new reaction, but the last step of any design procedure is to write a construction file and check it. To check it, you go through the steps of the cloning experiment in silico to simulate what would happen in the test tube. If it doesn't work in the computer, it's not going to work in the lab, and you can waste a lot of time and energy with a flawed design. So, you'll want to always always ALWAYS go through this in the computer before ordering oligos.

Once you've mastered this, let's simulate the cloning experiment.