Artificial transcriptional terminators
From OpenWetWare
| Line 30: | Line 30: | ||
==Designed terminators== | ==Designed terminators== | ||
The score d is calculated as mentioned above. The energy of hairpin formation, delG, is caluclated using UNAFold. | The score d is calculated as mentioned above. The energy of hairpin formation, delG, is caluclated using UNAFold. | ||
| + | |||
| + | These terminators are designed to be bidirectional. delG reverse is the energy of hairpin formation on the opposite strand. | ||
*Terminator 1: | *Terminator 1: | ||
Revision as of 16:11, 29 August 2006
The goal is to create a series of transcriptional terminators with varying efficiencies. The majority of transcriptional terminators have a G+C rich stem of 7(+/-1)bp and a loop of 4(+/-1) nucleodtides followed by a poly(U) tail. Two common loops are UUCG and GAAA, both of which are known to increase RNA hairpin stability. The sequence GCGGG(G) is a common sequence found on the 3' arm of the stem. [1]
Contents |
Effects of stem loop sequence on terminator efficiency
Bulges and mismatches in the stem, as well low G+C content of the stem will lower TE more than reducing the length of or elimination of the poly(U) tail [2]. The sequences downstream of the poly(U) tail and between the stop codon and the start of the stem loop structure also affect the TE of a terminator, particularly T7Te or T3Te.
- T7Te
Several sources [3] [Chamberlin 79] measured the termination efficiency(TE) of T7Te at around 90%. However, efficiency for the biobricks part BBa_B0012 [1], also T7Te, is around 30%. T7Te has a very short poly(U) tail and requires the further downstream sequence for efficiecent termination [3], and this further downstream sequence is lacking in BBa_B0012. If the sequence for BBa_B0012 is lengthened to include this downstream segment, then the TE of part should be improved.
Predicting terminator efficiency
It may be possible to predict terminator efficiency using methods from d'Aubenton, in particular, the score d assigned to a possible terminator sequence
d = nt*18.16+Y*96.59-116.87
where nt measures the statistical distribution of the T residues in the non transcribed DNA strand and Y is the free energy per nucleodtide of the stem loop structure.
The score d will give a rough estimate of how efficient a terminator is.
d<0: TE<20%
0<d<30: 20%<TE<70%
d>30: TE>70%
Ideal terminator
- has 6 base stem with 3' sequence of GCGGGG
- 4 base loop, either UUCG or GAAA
- tail containing >8 uridines
- for a biobrick part, flanking regions will be biobrick site
Designed terminators
The score d is calculated as mentioned above. The energy of hairpin formation, delG, is caluclated using UNAFold.
These terminators are designed to be bidirectional. delG reverse is the energy of hairpin formation on the opposite strand.
- Terminator 1:
delG=-12.6 d=59.31 %T>90
delG reverse=-10.2 d=44.82 %T>90
stem loop: ccccgcttcggcggggttttttttt
primer 1: gaattcgcggcgcttctagatcgcgtgaaaaaaaaaccccgcttcggc
primer 2: gcttcggcggggtttttttttcgcgagtactagtagcggcggctgcag
- Terminator 2:
delG=-12.6 d=35.78 %T>90
delG reverse=-10.2 d=21.28 %T=75
stem loop: ccccgcttcggcggggtttttt
primer 1: gaattcgcggcgcttctagatcgcgtggggaaaaaaccccgcttcggc
primer 2: gcttcggcggggttttttgggcgcgagtactagtagcggcggctgcag
- Terminator 3:
delG=-12.6 d=26.12 %T=80
delG reverse=-10.2 d=11.64 %T=40
stem loop: ccccgcttcggcggggttttt
primer 1: gaattcgcggcgcttctagatcgcgtgggggaaaaaccccgcttcggc
primer 2: gcttcggcggggtttttggggcgcgagtactagtagcggcggctgcag
- Terminator 4:
delG=-12.6 d=15.40 %T=55
delG reverse=-10.2 d=0.91 %T=<20
stem loop: ccccgcttcggcggggtttt
primer 1: gaattcgcggcgcttctagatcgcgtggggggaaaaccccgcttcggc
primer 2: gcttcggcggggttttgggggcgcgagtactagtagcggcggctgcag
- Terminator 5:
delG=-12.6 d=3.49 %T=25
delG reverse=-10.2 d=-11 %T<10
stem loop: ccccgcttcggcggggttt
primer 1: gaattcgcggcgcttctagatcgcgtgggggggaaaccccgcttcggc
primer 2: gcttcggcggggtttggggggcgcgagtactagtagcggcggctgcag
- Terminator 6:
delG=-16.2 d=54.38 %T>90
delG reverse=-18.9 d=66.22 %T>90
stem loop: ccccgccccugacagggcggggttttttttt
primer 1: gaattcgcggcgcttctagatcgcgtgaaaaaaaaaccccgccccugacagg
primer 2: cccugacagggcggggtttttttttcgcgagtactagtagcggcggctgcag
- Terminator 7:
delG=-16.2 d=30.84 %T=80
delG reverse=-18.9 d=42.69 %T>90
stem loop: ccccgccccugacagggcggggtttttt
primer 1: gaattcgcggcgcttctagatcgcgtggggaaaaaaccccgccccugacagg
primer 2: cccugacagggcggggttttttgggcgcgagtactagtagcggcggctgcag
- Terminator 8:
delG=-16.2 d=21.19 %T=70
delG reverse=-18.9 d=33.03 %T=80
stem loop: ccccgccccugacagggcggggttttt
primer 1: gaattcgcggcgcttctagatcgcgtgggggaaaaaccccgccccugacagg
primer 2: cccugacagggcggggtttttggggcgcgagtactagtagcggcggctgcag
- Terminator 9:
delG=-16.2 d=10.46 %T=40
delG reverse=-18.9 d=22.31 %T=75
stem loop: ccccgccccugacagggcggggtttt
primer 1: gaattcgcggcgcttctagatcgcgtggggggaaaaccccgccccugacagg
primer 2: cccugacagggcggggttttgggggcgcgagtactagtagcggcggctgcag
- Terminator 10:
delG=-16.2 d=-1.45 %T<10
delG reverse=-18.9 d=10.40 %T=40
stem loop: ccccgccccugacagggcggggttt
primer 1: gaattcgcggcgcttctagatcgcgtgggggggaaaccccgccccugacagg
primer 2: cccugacagggcggggtttggggggcgcgagtactagtagcggcggctgcag
- Terminator 11: this is not supposed to work. if it does, then something is wrong
delG=-3.3 d=-52.65 %T=0
delG reverse=-0.5 d=-69.56 %T=0
stem loop: ttttatgaaaataaaattt
primer 1: gaattcgcggcgcttctagatcgcgtgggggggaaattttatgaaaat
primer 2: atgaaaataaaatttggggggcgcgagtactagtagcggcggctgcag
References
- d'Aubenton Carafa Y, Brody E, and Thermes C. . pmid:1702475.
- Abe H and Aiba H. . pmid:9150882.
- Reynolds R and Chamberlin MJ. . pmid:1372366.
- Brendel V, Hamm GH, and Trifonov EN. . pmid:3078109.
- Cheng SW, Lynch EC, Leason KR, Court DL, Shapiro BA, and Friedman DI. . pmid:1835546.
- Christie GE, Farnham PJ, and Platt T. . pmid:7027254.
- Ermolaeva MD, Khalak HG, White O, Smith HO, and Salzberg SL. . pmid:10926490.
- Lesnik EA, Sampath R, Levene HB, Henderson TJ, McNeil JA, and Ecker DJ. . pmid:11522828.
- Lynn SP, Kasper LM, and Gardner JF. . pmid:2961747.
- Petrillo M, Silvestro G, Di Nocera PP, Boccia A, and Paolella G. . pmid:16820051.
- Reynolds R, Bermúdez-Cruz RM, and Chamberlin MJ. . pmid:1372365.
- Unniraman S, Prakash R, and Nagaraja V. . pmid:11809879.
- Uptain SM and Chamberlin MJ. . pmid:9391063.
- von Hippel PH and Yager TD. . pmid:1536005.
- Wilson KS and von Hippel PH. . pmid:7966320.
- Wilson KS and von Hippel PH. . pmid:7568019.
- Yager TD and von Hippel PH. . pmid:1703438.
- Gusarov I and Nudler E. . pmid:10230402.
- de Hoon MJ, Makita Y, Nakai K, and Miyano S. . pmid:16110342.


