Artificial transcriptional terminators

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(6 intermediate revisions not shown.)
Line 30: Line 30:
==Designed terminators==
==Designed terminators==
The score d is calculated as mentioned above.  The energy of hairpin formation, delG, is caluclated using UNAFold.
The score d is calculated as mentioned above.  The energy of hairpin formation, delG, is caluclated using UNAFold.
These terminators are designed to be bidirectional.  delG reverse is the energy of hairpin formation on the opposite strand.
*Terminator 1:
*Terminator 1:
delG=-12.6 d=59.31 %T>90
delG=-12.6 d=62.33 %T>90
delG reverse=-10.2 d=44.82 %T>90
delG reverse=-10.2 d=53.09 %T>90
stem loop: ccccgcttcggcggggttttttttt
primer 1: gaattcgcggcgcttctagatcgcgtgaaaaaaaaaccccgcttcggc
primer 2: gcttcggcggggtttttttttcgcgagtactagtagcggcggctgcag
*Terminator 2:
*Terminator 2:
delG=-12.6 d=35.78 %T>90
delG=-12.6 d=38.25 %T>90
delG reverse=-10.2 d=21.28 %T=75
delG reverse=-10.2 d=23.02 %T=75
stem loop: ccccgcttcggcggggtttttt
primer 1: gaattcgcggcgcttctagatcgcgtggggaaaaaaccccgcttcggc
primer 2: gcttcggcggggttttttgggcgcgagtactagtagcggcggctgcag
*Terminator 3:
*Terminator 3:
delG=-12.6 d=26.12 %T=80
delG=-12.6 d=27.78 %T=80
delG reverse=-10.2 d=11.64 %T=40
delG reverse=-10.2 d=11.64 %T=40
stem loop: ccccgcttcggcggggttttt
primer 1: gaattcgcggcgcttctagatcgcgtgggggaaaaaccccgcttcggc
primer 2: gcttcggcggggtttttggggcgcgagtactagtagcggcggctgcag
*Terminator 4:
*Terminator 4:
delG=-12.6 d=15.40 %T=55
delG=-12.6 d=16.05 %T=55
delG reverse=-10.2 d=0.91 %T=<20
delG reverse=-10.2 d=0.91 %T=<20
stem loop: ccccgcttcggcggggtttt
primer 1: gaattcgcggcgcttctagatcgcgtggggggaaaaccccgcttcggc
primer 2: gcttcggcggggttttgggggcgcgagtactagtagcggcggctgcag
*Terminator 5:
*Terminator 5:
delG=-12.6 d=3.49 %T=25
delG=-12.6 d=4.22 %T=25
delG reverse=-10.2 d=-11 %T<10
delG reverse=-10.2 d=-11 %T<10
stem loop: ccccgcttcggcggggttt
primer 1: gaattcgcggcgcttctagatcgcgtgggggggaaaccccgcttcggc
primer 2: gcttcggcggggtttggggggcgcgagtactagtagcggcggctgcag
*Terminator 6:
*Terminator 6:
delG=-16.2 d=54.38 %T>90
delG=-16.2 d=57.39 %T>90
delG reverse=-18.9 d=66.22 %T>90
delG reverse=-18.9 d=66.22 %T>90
stem loop: ccccgccccugacagggcggggttttttttt
primer 1: gaattcgcggcgcttctagatcgcgtgaaaaaaaaaccccgccccugacagg
primer 2: cccugacagggcggggtttttttttcgcgagtactagtagcggcggctgcag
*Terminator 7:
*Terminator 7:
delG=-16.2 d=30.84 %T=80
delG=-16.2 d=33.32 %T=80
delG reverse=-18.9 d=42.69 %T>90
delG reverse=-18.9 d=42.69 %T>90
stem loop: ccccgccccugacagggcggggtttttt
primer 1: gaattcgcggcgcttctagatcgcgtggggaaaaaaccccgccccugacagg
primer 2: cccugacagggcggggttttttgggcgcgagtactagtagcggcggctgcag
*Terminator 8:
*Terminator 8:
delG=-16.2 d=21.19 %T=70
delG=-16.2 d=22.84 %T=70
delG reverse=-18.9 d=33.03 %T=80
delG reverse=-18.9 d=33.03 %T=80
stem loop: ccccgccccugacagggcggggttttt
primer 1: gaattcgcggcgcttctagatcgcgtgggggaaaaaccccgccccugacagg
primer 2: cccugacagggcggggtttttggggcgcgagtactagtagcggcggctgcag
*Terminator 9:
*Terminator 9:
delG=-16.2 d=10.46 %T=40
delG=-16.2 d=11.56 %T=40
delG reverse=-18.9 d=22.31 %T=75
delG reverse=-18.9 d=22.31 %T=75
stem loop: ccccgccccugacagggcggggtttt
primer 1: gaattcgcggcgcttctagatcgcgtggggggaaaaccccgccccugacagg
primer 2: cccugacagggcggggttttgggggcgcgagtactagtagcggcggctgcag
*Terminator 10:
*Terminator 10:
delG=-16.2 d=-1.45 %T<10
delG=-16.2 d=-0.72 %T<10
delG reverse=-18.9 d=10.40 %T=40
delG reverse=-18.9 d=10.40 %T=40
stem loop: ccccgccccugacagggcggggttt
primer 1: gaattcgcggcgcttctagatcgcgtgggggggaaaccccgccccugacagg
primer 2: cccugacagggcggggtttggggggcgcgagtactagtagcggcggctgcag
Line 167: Line 169:
delG reverse=-0.5 d=-69.56 %T=0
delG reverse=-0.5 d=-69.56 %T=0
stem loop: ttttatgaaaataaaattt
primer 1: gaattcgcggcgcttctagatcgcgtgggggggaaattttatgaaaat
primer 2: atgaaaataaaatttggggggcgcgagtactagtagcggcggctgcag
Line 194: Line 196:
# Gusarov99 pmid=10230402
# Gusarov99 pmid=10230402
# deHoon05 pmid=16110342
# deHoon05 pmid=16110342
# Smolke06 pmid=16845378
# Nudler02 pmid=12167155

Revision as of 15:19, 5 September 2006

The goal is to create a series of transcriptional terminators with varying efficiencies. The majority of transcriptional terminators have a G+C rich stem of 7(+/-1)bp and a loop of 4(+/-1) nucleodtides followed by a poly(U) tail. Two common loops are UUCG and GAAA, both of which are known to increase RNA hairpin stability. The sequence GCGGG(G) is a common sequence found on the 3' arm of the stem. [1]


Effects of stem loop sequence on terminator efficiency

Bulges and mismatches in the stem, as well low G+C content of the stem will lower TE more than reducing the length of or elimination of the poly(U) tail [2]. The sequences downstream of the poly(U) tail and between the stop codon and the start of the stem loop structure also affect the TE of a terminator, particularly T7Te or T3Te.

  • T7Te

Several sources [3] [Chamberlin 79] measured the termination efficiency(TE) of T7Te at around 90%. However, efficiency for the biobricks part BBa_B0012 [1], also T7Te, is around 30%. T7Te has a very short poly(U) tail and requires the further downstream sequence for efficiecent termination [3], and this further downstream sequence is lacking in BBa_B0012. If the sequence for BBa_B0012 is lengthened to include this downstream segment, then the TE of part should be improved.

Predicting terminator efficiency

It may be possible to predict terminator efficiency using methods from d'Aubenton, in particular, the score d assigned to a possible terminator sequence

d = nt*18.16+Y*96.59-116.87

where nt measures the statistical distribution of the T residues in the non transcribed DNA strand and Y is the free energy per nucleodtide of the stem loop structure.

The score d will give a rough estimate of how efficient a terminator is.

d<0: TE<20%

0<d<30: 20%<TE<70%

d>30: TE>70%

Ideal terminator

  • has 6 base stem with 3' sequence of GCGGGG
  • 4 base loop, either UUCG or GAAA
  • tail containing >8 uridines
  • for a biobrick part, flanking regions will be biobrick site

Designed terminators

The score d is calculated as mentioned above. The energy of hairpin formation, delG, is caluclated using UNAFold.

These terminators are designed to be bidirectional. delG reverse is the energy of hairpin formation on the opposite strand.

  • Terminator 1:

delG=-12.6 d=62.33 %T>90

delG reverse=-10.2 d=53.09 %T>90




  • Terminator 2:

delG=-12.6 d=38.25 %T>90

delG reverse=-10.2 d=23.02 %T=75




  • Terminator 3:

delG=-12.6 d=27.78 %T=80

delG reverse=-10.2 d=11.64 %T=40




  • Terminator 4:

delG=-12.6 d=16.05 %T=55

delG reverse=-10.2 d=0.91 %T=<20




  • Terminator 5:

delG=-12.6 d=4.22 %T=25

delG reverse=-10.2 d=-11 %T<10




  • Terminator 6:

delG=-16.2 d=57.39 %T>90

delG reverse=-18.9 d=66.22 %T>90




  • Terminator 7:

delG=-16.2 d=33.32 %T=80

delG reverse=-18.9 d=42.69 %T>90




  • Terminator 8:

delG=-16.2 d=22.84 %T=70

delG reverse=-18.9 d=33.03 %T=80




  • Terminator 9:

delG=-16.2 d=11.56 %T=40

delG reverse=-18.9 d=22.31 %T=75




  • Terminator 10:

delG=-16.2 d=-0.72 %T<10

delG reverse=-18.9 d=10.40 %T=40




  • Terminator 11: this is not supposed to work. if it does, then something is wrong

delG=-3.3 d=-52.65 %T=0

delG reverse=-0.5 d=-69.56 %T=0





Error fetching PMID 9150882:
Error fetching PMID 1702475:
Error fetching PMID 3078109:
Error fetching PMID 1835546:
Error fetching PMID 7027254:
Error fetching PMID 10926490:
Error fetching PMID 11522828:
Error fetching PMID 2961747:
Error fetching PMID 16820051:
Error fetching PMID 1372365:
Error fetching PMID 1372366:
Error fetching PMID 11809879:
Error fetching PMID 9391063:
Error fetching PMID 1536005:
Error fetching PMID 7966320:
Error fetching PMID 7568019:
Error fetching PMID 1703438:
Error fetching PMID 10230402:
Error fetching PMID 16110342:
Error fetching PMID 16845378:
Error fetching PMID 12167155:
  1. Error fetching PMID 1702475: [Aubenton90]
  2. Error fetching PMID 9150882: [Abe96]
  3. Error fetching PMID 1372366: [Reynolds92II]
  4. Error fetching PMID 3078109: [Bredel86]
  5. Error fetching PMID 1835546: [Cheng91]
  6. Error fetching PMID 7027254: [Christie81]
  7. Error fetching PMID 10926490: [Ermolaeva00]
  8. Error fetching PMID 11522828: [Lesnik01]
  9. Error fetching PMID 2961747: [Lynn88]
  10. Error fetching PMID 16820051: [Petrillo06]
  11. Error fetching PMID 1372365: [Reynolds92I]
  12. Error fetching PMID 11809879: [Unniraman02]
  13. Error fetching PMID 9391063: [Uptain97]
  14. Error fetching PMID 1536005: [VonHippel92]
  15. Error fetching PMID 7966320: [Wilson94]
  16. Error fetching PMID 7568019: [Wilson95]
  17. Error fetching PMID 1703438: [Yager91]
  18. Error fetching PMID 10230402: [Gusarov99]
  19. Error fetching PMID 16110342: [deHoon05]
  20. Error fetching PMID 16845378: [Smolke06]
  21. Error fetching PMID 12167155: [Nudler02]
All Medline abstracts: PubMed HubMed
Personal tools