BE.109:Systems engineering/Measuring DNA, RNA, protein - Revision history

Josting at 19:09, 20 April 2006

Josting — Thu, 20 Apr 2006 19:09:16 GMT

←Older revision		Revision as of 19:09, 20 April 2006
Line 69:		Line 69:

	Use the following pattern to help you plan your reactions. You will need two strips of 8 PCR tubes, two strips of caps, and a cold block to use as you assemble the reactions. <b> Each of your reactions today should have a final volume of 25 μl. </b>		Use the following pattern to help you plan your reactions. You will need two strips of 8 PCR tubes, two strips of caps, and a cold block to use as you assemble the reactions. <b> Each of your reactions today should have a final volume of 25 μl. </b>
		+
		+	====1st strip of 8 tubes====

	{\| border="1"		{\| border="1"
Line 89:		Line 91:
	\| <font color="green">cDNA</font>		\| <font color="green">cDNA</font>
	\| <font color="green">cDNA</font>		\| <font color="green">cDNA</font>
		+	\|}
		+
		+
		+
		+	#You should prepare a “master mix cocktail” sufficient for four reactions. Each reaction will have cDNA (1 μl/reaction), primers (0.5 μl of the forward primer and 0.5 μl of the reverse primer/reaction), reaction mix (12.5 μl of 2X mix), and water. Since you have two samples of cDNA you will prepare two such master mixes. Aliquot the reactions into the PCR tubes using the pattern above.
		+	# You should prepare one complete reaction (no RT cDNA, primers, reaction mix and water) for each of your “no reverse transcriptase” controls.
		+
		+	====2nd strip of 8 tubes====
		+
		+	{\| border="1"
		+	\|-
		+	! 1
		+	! 2
		+	! 3
		+	! 4
		+	! 5
		+	! 6
		+	! 7
		+	! 8
	\|-		\|-
	\| DNA standard 1		\| DNA standard 1
Line 100:		Line 121:
	\|}		\|}

-	~~====1st strip of 8 tubes====~~
-	#You should prepare a “master mix cocktail” sufficient for four reactions. Each reaction will have cDNA (1 μl/reaction), primers (0.5 μl of the forward primer and 0.5 μl of the reverse primer/reaction), reaction mix (12.5 μl of 2X mix), and water. Since you have two samples of cDNA you will prepare two such master mixes. Aliquot the reactions into the PCR tubes using the pattern above.
-	~~# You should prepare one complete reaction (no RT cDNA, primers, reaction mix and water) for each of your “no reverse transcriptase” controls.~~

-	~~====2nd strip of 8 tubes====~~
	# You should prepare a master mix cocktail sufficient for 8 reactions, each with 12.5 μl of 2X reaction mix, 0.5 μl forward primer, 0.5 μl reverse primer, and enough water to bring the volume to 24 μl. Aliquot these into the first 7 tubes of the second strip.		# You should prepare a master mix cocktail sufficient for 8 reactions, each with 12.5 μl of 2X reaction mix, 0.5 μl forward primer, 0.5 μl reverse primer, and enough water to bring the volume to 24 μl. Aliquot these into the first 7 tubes of the second strip.
	# Serially dilute the DNA you isolated from cells with the Lyse-N-Go protocol, making 1:10 dilutions in water.		# Serially dilute the DNA you isolated from cells with the Lyse-N-Go protocol, making 1:10 dilutions in water.

Nkuldell: /* For next time */

Nkuldell — Thu, 20 Apr 2006 17:01:31 GMT

For next time

←Older revision		Revision as of 17:01, 20 April 2006
Line 128:		Line 128:
	# What do the following controls “control” for? That is, what can their amount of product tell you?		# What do the following controls “control” for? That is, what can their amount of product tell you?
	#* no reverse transcriptase in the cDNA synthesis reactions		#* no reverse transcriptase in the cDNA synthesis reactions
-	~~#* no reverse transcriptase cDNA in the q-PCR~~
	#* plus primers, no cDNA, plus Taq reaction mix		#* plus primers, no cDNA, plus Taq reaction mix
	#* no primers, no cDNA, plus Taq reaction mix		#* no primers, no cDNA, plus Taq reaction mix

Nkuldell: /* 2nd strip of 8 tubes */

Nkuldell — Tue, 18 Apr 2006 16:30:57 GMT

2nd strip of 8 tubes

←Older revision		Revision as of 16:30, 18 April 2006
Line 106:		Line 106:
	====2nd strip of 8 tubes====		====2nd strip of 8 tubes====
	# You should prepare a master mix cocktail sufficient for 8 reactions, each with 12.5 μl of 2X reaction mix, 0.5 μl forward primer, 0.5 μl reverse primer, and enough water to bring the volume to 24 μl. Aliquot these into the first 7 tubes of the second strip.		# You should prepare a master mix cocktail sufficient for 8 reactions, each with 12.5 μl of 2X reaction mix, 0.5 μl forward primer, 0.5 μl reverse primer, and enough water to bring the volume to 24 μl. Aliquot these into the first 7 tubes of the second strip.
-	# Serially dilute the DNA you isolated from cells, making 1:10 dilutions in water.	+	# Serially dilute the DNA you isolated from cells with the Lyse-N-Go protocol, making 1:10 dilutions in water.
	# Add 1 μl of undiluted DNA to first tube in the second strip.		# Add 1 μl of undiluted DNA to first tube in the second strip.
	# Add 1 μl of each dilution to the following 5 tubes in the second strip.		# Add 1 μl of each dilution to the following 5 tubes in the second strip.

Nkuldell: /* 2nd strip of 8 tubes */

Nkuldell — Mon, 17 Apr 2006 19:01:39 GMT

2nd strip of 8 tubes

←Older revision		Revision as of 19:01, 17 April 2006
Line 112:		Line 112:
	# The 8th tube of the second strip should be a "blank" reaction which leaves out both template and primers. Specifically, this reaction should have only 2X reaction mix and water.		# The 8th tube of the second strip should be a "blank" reaction which leaves out both template and primers. Specifically, this reaction should have only 2X reaction mix and water.

-	When everyone is ready we will walk our samples to the BioMicroCenter in Building 68 and begin the q-PCR cycles.	+	When everyone is ready we will walk our samples to the BioMicroCenter in Building 68 and begin the q-PCR cycles.
		+	##94° 3 minutes
		+	##94° 15 seconds
		+	##53° 30 seconds
		+	##72° 30 seconds
		+	##Plate read
		+	##repeat steps 2-5, 35 times
		+	##melting curve 65°-95°C, read every 0.5°C
		+	##end

	DONE!		DONE!

Nkuldell: /* 2nd strip of 8 tubes */

Nkuldell — Mon, 17 Apr 2006 18:33:28 GMT

2nd strip of 8 tubes

←Older revision		Revision as of 18:33, 17 April 2006
Line 105:		Line 105:

	====2nd strip of 8 tubes====		====2nd strip of 8 tubes====
-	# You should prepare a master mix cocktail sufficient for 8 reactions, each with 12.5 μl of 2X reaction mix, 0.5 μl forward primer, 0.5 μl reverse primer, and enough water to bring the volume to 24 μl. Aliquot these into the first 6 tubes of the ~~third~~ strip.	+	# You should prepare a master mix cocktail sufficient for 8 reactions, each with 12.5 μl of 2X reaction mix, 0.5 μl forward primer, 0.5 μl reverse primer, and enough water to bring the volume to 24 μl. Aliquot these into the first 7 tubes of the second strip.
-	# Serially dilute the DNA you isolated from cells, making 1:10 dilutions in water	+	# Serially dilute the DNA you isolated from cells, making 1:10 dilutions in water.
-	# Add 1 μl of undiluted DNA to first tube in the ~~third~~ strip.	+	# Add 1 μl of undiluted DNA to first tube in the second strip.
-	# Add 1 μl of each dilution to the following 5 tubes in the ~~third~~ strip.	+	# Add 1 μl of each dilution to the following 5 tubes in the second strip.
-	# ~~Prepare a~~ "primers only" reaction ~~which leaves out any template~~. ~~Make up~~ the ~~difference in volume with water~~.	+	# The 7th tube of the second strip should be your "primers only" reaction. There should be enough volume in the cocktail you prepared for this reaction.
-	# ~~Prepare~~ a "blank" reaction which leaves out both template and primers. ~~Again~~, ~~make up the difference in volume with~~ water.	+	# The 8th tube of the second strip should be a "blank" reaction which leaves out both template and primers. Specifically, this reaction should have only 2X reaction mix and water.

	When everyone is ready we will walk our samples to the BioMicroCenter in Building 68 and begin the q-PCR cycles.		When everyone is ready we will walk our samples to the BioMicroCenter in Building 68 and begin the q-PCR cycles.

Nkuldell: /* Part 2: q-PCR */

Nkuldell — Mon, 17 Apr 2006 18:02:30 GMT

Part 2: q-PCR

←Older revision		Revision as of 18:02, 17 April 2006
Line 68:		Line 68:
	You will also make serial dilutions of DNA template to generate a fluorescence vs concentration standard curve. The source of DNA for these reactions will be the lysed cells you prepared last time. From the number of cells, you’ll know the number of ''LacZ'' templates you’re adding to each tube. Next time you will assess the accumulation of ''LacZ'' products as a function of cell number, then use this standard curve to determine the number of copies in each of your cDNA reactions, expressing the result and # of ''LacZ'' mRNA/cell.		You will also make serial dilutions of DNA template to generate a fluorescence vs concentration standard curve. The source of DNA for these reactions will be the lysed cells you prepared last time. From the number of cells, you’ll know the number of ''LacZ'' templates you’re adding to each tube. Next time you will assess the accumulation of ''LacZ'' products as a function of cell number, then use this standard curve to determine the number of copies in each of your cDNA reactions, expressing the result and # of ''LacZ'' mRNA/cell.

-	Use the following pattern to help you plan your reactions. You will need two strips of 8 PCR tubes, two strips of caps, and a cold block to use as you assemble the reactions. Each of your reactions today should have a final volume of 25 μl.	+	Use the following pattern to help you plan your reactions. You will need two strips of 8 PCR tubes, two strips of caps, and a cold block to use as you assemble the reactions. <b> Each of your reactions today should have a final volume of 25 μl. </b>

	{\| border="1"		{\| border="1"

Nkuldell: /* Protocol for Invitrogen kit */

Nkuldell — Mon, 17 Apr 2006 17:51:42 GMT

Protocol for Invitrogen kit

←Older revision		Revision as of 17:51, 17 April 2006
Line 45:		Line 45:
	#* ___ μl Rnase free H2O		#* ___ μl Rnase free H2O
	#* ___ μl RNA (ideally 1μg but 0.5 μg for each sample is OK if volume would be >16 μl)		#* ___ μl RNA (ideally 1μg but 0.5 μg for each sample is OK if volume would be >16 μl)
-	#* 2 μl ~~Random~~ hexamers (50 ng/μl)	+	#* 2 μl random hexamers (50 ng/μl)
	#* 2 μl 10 mM dNTP mix		#* 2 μl 10 mM dNTP mix
	#* to a final volume of 20 μl		#* to a final volume of 20 μl

Nkuldell: /* Protocol for Invitrogen kit */

Nkuldell — Mon, 17 Apr 2006 17:51:24 GMT

Protocol for Invitrogen kit

←Older revision		Revision as of 17:51, 17 April 2006
Line 44:		Line 44:
	# In an RNase-free PCR tube mix		# In an RNase-free PCR tube mix
	#* ___ μl Rnase free H2O		#* ___ μl Rnase free H2O
-	#* ___ μl RNA (ideally 1μg but 0.5 μg for each sample is OK if volume would be > μl)	+	#* ___ μl RNA (ideally 1μg but 0.5 μg for each sample is OK if volume would be >16 μl)
	#* 2 μl Random hexamers (50 ng/μl)		#* 2 μl Random hexamers (50 ng/μl)
	#* 2 μl 10 mM dNTP mix		#* 2 μl 10 mM dNTP mix

Nkuldell: /* SYBR GREEN PCR reaction mix */

Nkuldell — Mon, 17 Apr 2006 17:33:00 GMT

SYBR GREEN PCR reaction mix

←Older revision		Revision as of 17:33, 17 April 2006
Line 150:		Line 150:

	===SYBR GREEN PCR reaction mix===		===SYBR GREEN PCR reaction mix===
		+	Applied Biosystems Power SYBR Green PCR Master Mix (cat #4368577)

Nkuldell: /* LacZ primers */

Nkuldell — Mon, 17 Apr 2006 17:29:27 GMT

LacZ primers

←Older revision		Revision as of 17:29, 17 April 2006
Line 132:		Line 132:
	Invitrogen SuperScript III First-Strand Synthesis kit (cat #18080-051)		Invitrogen SuperScript III First-Strand Synthesis kit (cat #18080-051)

-	===LacZ primers===	+	===LacZ primers for 3075 bp ORF===
		+
		+	<b>5' end of LacZ gene <br></b>
		+	Forward is 20-mer starting at bp 238: 5'- CCTGAGGCCGATACTGTCGT<br>
		+	Reverse is 19-mer starting at bp 308: 5'- TTGGTGTAGATGGGCGCAT<br>
		+	Product: 70 bp long
		+
		+	<b>Middle of LacZ gene <br> </b>
		+	Forward is 18-mer starting at bp 1260: 5'- CATGGTGCCAATGAATCG <br>
		+	Reverse is 20-mer starting at bp 1375: 5'- GCGACCAGATGATCACACTC<br>
		+	Product: 115 bp long<br>
		+
		+	<b> 3' end of LacZ gene <br> </b>
		+	Forward is 21-mer starting at bp 2567: 5'-CCTACCGGATTGATGGTAGTG<br>
		+	Reverse is 18-mer starting at bp 2664: 5'-CTGGCAGTTCAGGCCAAT<br>
		+	Product: 102 bp long
		+
	===SYBR GREEN PCR reaction mix===		===SYBR GREEN PCR reaction mix===