BIOL368/F14:Nicole Anguiano Week 2

From OpenWetWare
Revision as of 21:28, 9 September 2014 by Nicole Anguiano (talk | contribs) (→‎Conclusions: Added a conclusion)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search


Electronic Lab Notebook

Methods

  • I began by launching the Aipotu program and switching to the “Molecular Biology” tab. I loaded “Green-2”, and selected Compare > Upper vs. Lower in the top bar. The window displayed the differences between the genes, located at positions 79 and 80. Next, I selected the “White” flower. I also did Compare > Upper vs. Lower in the top bar, and it showed that the alleles were identical.
  • I then selected the “Red” flower and selected the base at position 20. I switched it from a “G” to a “C”, then clicked “Fold Protein”. The resulting protein didn’t display in the history list, indicating no protein would be created. I added the new flower under the name “New-White”. I then compared the Upper allele of the “White” flower with the lower allele of the “New-White” flower, and found differences in positions 7, 11, 12, and 80. After that, I compared the Upper allele of the “New-White” flower with the lower allele of the “White” flower, and found differences in positions 12, 15, 16, 18, 19, 20, 21, and 80.
  • I then selected “Red” and put its Upper, red allele into the history list. I selected “Green-2” and moved its Upper, blue allele into the history list as well. I then selected the “White” flower and imported the red allele into the upper gene, and the blue allele into the lower gene, and added the new purple flower under the name “Purple”. I compared the Upper and lower alleles of the purple flower and found that the only difference between them was in position 79.
  • Comparing the amino acid sequence, the upper, red allele had a Phe where the lower allele had a Tyr. To the left of the Tyr on the lower blue allele, I added the DNA code “TTC”, which inserted a Phe into the gene. I folded the protein and created a purple allele. I sent the purple allele to the upper gene and added the pure-breeding purple flower under the name “True-Purple”.
  • Next I selected the “Red” flower. After the 21st base of the upper gene, I added the following sequence: TTAGTTAAAGAAATTGCTATGTATCGTTTTGCTACTCATGAACG. This sequence is responsible for the string of amino acids Leu-Val-Lys-Glu-Ile-Ala-Met-Tyr-Arg-Phe-Ala-Thr-His-Glu-Arg, or LVKEIAMYRFATHER. I removed the 69th base to the 137th base by manually deleting them starting from the 137th base, and after removing that I also removed the 65th base: T. This gave me an amino acid sequence of Met-Leu-Val-Lys-Glu-Ile-Ala-Met-Tyr-Arg-Phe-Ala-Thr-His-Glu-Arg, or MLVKEIAMYRFATHER.

Results

Specific Task Answers:

  1. What are the differences in the DNA sequences of the alleles you defined in Part I?
    • See Figure 3 below.
  2. Do all the white alleles have the same DNA sequence?
    • See Figure 3 below.
  3. Which DNA sequences are found in each of the four starting organisms?
    • Green-1:
      • Upper: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT
      • Lower: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT
    • Green-2:
      • Upper: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTACTGTCGGCAGTAGTAGGGGGCGT
      • Lower: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTGGTGTCGGCAGTAGTAGGGGGCGT
    • Red:
      • Upper: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT
      • Lower: CAGCTATGACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGTTCTGTCGGCAGTAGTAGGGGGCGT
    • White:
      • Upper: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT
      • Lower: CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTGCGCTATACAAAGGTTAGTGGTCTGTCGGCAGTAGTAGGGGGCGT
  4. Using this knowledge, construct a pure-breeding purple organism.
    • Figure 1: An image showing the pure-breeding purple flower. Both alleles are purple and the combined effect of them is also purple.
  5. Advanced tasks: How does the DNA sequence of the different alleles explain the effects of mutations you found in part I?
    • The mutations that cause a colored protein to become a white protein are a result of the DNA sequence being altered in such a way that the DNA sequence no longer can form a protein. The mRNA sequence is not translated into a protein, meaning no pigment is created at all, leading to a pure white flower due to a lack of pigment. The alleles that code for colors that typically are not seen as true-breeding plants (for example, purple flowers typically only resulting from a red and a blue allele) result from an alteration of the DNA sequence of one of the alleles that causes it to begin carrying the allele for the other color as well as itself. The orange allele results from a DNA sequence that includes the code for the two amino acids responsible for the creation of the red (Phe) and the yellow (Trp) pigment. The green allele results from a DNA sequence that includes the code for the two amino acids responsible for the creation of the yellow (Trp) and blue (Tyr) pigments. The purple allele results from a DNA sequence that includes the code for the two amino acids responsible for the creation of the red (Phe) and blue (Tyr) pigments.
  6. Try making this protein: MLVKEIAMYRFATHER (“M LVKE I AM YR FATHER” thanks to Grier Belter and Griffin Hancock from the Nova Classical Academy)
    • Figure 2: An image of a DNA sequence that codes for MLVKEIAMYRFATHER, or Met-Leu-Val-Lys-Glu-Ile-Ala-Met-Tyr-Arg-Phe-Ala-Thr-His-Glu-Arg.

Tables and Questions:

  • (a) and (b)
Allele Color Change(s) in Amino Acid Sequence Change(s) in DNA Sequence
Green-2: Cb, Cy Blue, Yellow 10th amino acid: Tyr in Cb, Trp in Cy 79 and 80: AC in Cb and GG in Cy
White: Cw, Cw White, White Identical Identical
New-White: C1w, C2w White, White Neither has a protein sequence 7: A in C1w and G in C2w; 20: C in C1w and absent in C2w
White: Cw, New-White: C2w White, White C2w has no protein sequence. 7: A in Cw and G in C2w; 11 and 12: GT in Cwand absent in C2w; 80: G in Cw and T in C2w
New-White: C1w, White: Cw White, White C1w has no protein sequence. 12: A in C1w, T in Cw; 15 and 16: -T in C1w and GA in Cw; 18-21: GATC in C1w and TGAT in Cw; 80: T in C1w and G in Cw

Figure 3: The table comparing the white alleles in White and New-White, as well as the alleles in Green-2.

  • Are the white alleles the same?

White alleles that create a protein are the same. However, white alleles that do not create a protein are different from both protein-creating alleles and each other.

  • (c)

See number 3 above under "Specific Task Answers".

  • (d) Explain why it is purple and pure-breeding.

The difference between the red and blue alleles lies in the 10th amino acid. In the blue allele, it is Tyr, and in the red allele, it is Phe. Adding the Phe amino acid to the blue allele next to the Tyr creates a purple allele. As Phe and Tyr are present in the dominant alleles, the combination of the two expresses both blue and red, allowing the creation of a pure-breeding purple flower with the new purple allele.

Conclusions

Alleles are responsible for the coloration of the petals of a flower. However, the DNA sequence behind these alleles can explain why the flowers are colored the way they are. Using the software Aioptu, the DNA sequences behind each allele can be analyzed and manipulated. From this, it was discovered that blue alleles result from the pigment molecule's inclusion of DNA sequences containing code for the amino acid tyrosine, yellow alleles from DNA sequences containing code for the amino acid tryptophan, red alleles from DNA sequences containing code for the amino acid phenylalanine, and white alleles from DNA sequences that do not contain code for any of the amino acids responsible for the other pigment proteins. Typically, these three alleles are combined in various ways in flowers to create the various colors, with yellow and blue forming green flowers, red and blue forming purple flowers, and so on. This would make it seem impossible to obtain true-breeding variants of any color that is not red, blue, yellow, or white. However, there exist true-breeding variants that can arise via mutation. This is possible due to the amino acids that code for the individual pigments. If an allele contains both tyrosine (contained in blue alleles) and phenylalanine (contained in red alleles), the pigment protein produced by the resulting DNA sequence will be purple, allowing for a true-breeding purple organism to exist. Similarly, if an allele contains both tyrosine and tryptophan (contained in yellow alleles), the resulting pigment protein will be green. Similarly, white alleles are created when no pigment-producing amino acid is present in the sequence. However, a white allele can also result from a DNA sequence which produces no protein at all.

Links

Nicole Anguiano
BIOL 368, Fall 2014

Assignment Links
Individual Journals
Class Journals
Retrieved from "https://openwetware.org/mediawiki/index.php?title=BIOL368/F14:Nicole_Anguiano_Week_2&oldid=818351"