BIOMOL LCS/2010:TP 1

From OpenWetWare

Revision as of 16:47, 15 March 2010 by Ana Luisa Van Innis (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search


Início        Pessoas        Material de apoio        Programa Teóricas        Programa TPs        Ajuda       

Contents

Introdução ao OpenWetWare

  • Edição de páginas
  • Criação do "Caderno de Apontamentos"

Procedimento

  1. Faça login na sua área pessoal do OpenWetWare.
  2. Edite as informações que entender
  3. Crie um Notebook pessoal (utilize o link na barra de navegação à esquerda)
  4. Em cada aula TP:
    1. Crie uma entrada do dia
    2. Faça "copy paste" do código e texto com o exercício da aula
    3. Escreva as suas respostas às questões directamente no Caderno de Apontamentos
  5. Após a aula, consulte o caderno do docente para tirar dúvidas sobre as suas respostas
  6. Introduza os seus comentários sobre a aula na página de "Talk" respectiva



Exercício

Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

  • Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos?

DNA (DNA nuclear e DNA mitocondrial) que apresenta as bases adenina(A),timina(T),guanina(G) e citosina(C), sendo que na dupla hélice do DNA a guanina emparelha sempre com a citosina, e a timina emparelha sempre com a adenina. esta molécula também pode representar o RNA, contudo, a molécula de RNA apresenta uracilo(U) em vez de timina.

  • Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real.

Uma apresentação alternativa que represente melhor a estrutura real do DNA seria a representação em dupla hélice(com as duas sequências de 5' para 3' e de 3' para 5' emparelhadas de forma complementar). Neste esquema de emparelhamento a Timina encontra-se ligada por duas pontes de hidrogénio à adenina e a guanina encontra-se ligada por três pontes de hidrogénio à citosina.

  • Poderá esta sequência conter um gene? Justifique a sua resposta.

Para conter um gene esta sequência teria de apresentar um codão de iniciação ATG (metionina) e um codão stop (UAA, TAG e TGA). Verifica-se que nesta sequência, dependendo da posição da grelha de leitura, temos codões de iniciação e codões de STOP, o que significa que esta pode conter um gene


  • Indique o resultado da transcrição desta sequência.

UUGACACUACCGAGGUGUACUAUUUUUACCCGAGUCGCUAAUUUUUGCCGCAAGGUGCUAAGCCGCGAGGAAA GCGAGGCUGAACAGGCAGUCGCCCGUCCACAGGUGACGGUGAUCCCGCGUGAGCAGCAUGCUAUUUCCCGCAAAGA UAUCAGUGAAAAUGCCCUGAAGGUAAUGUACAGGCUCAAUAAAGCGGGAUACGAAGCCUGG


  • É possível prever que proteína se encontra codificada numa sequência nucleotídica?

Como? Sim, ao escolher uma grelha de leitura podemos usar o código genético para transcrever a sequência, pois cada proteína tem uma sequência especifica de AA. Ao traduzir esta sequência de nucleotidos (cada 3 nucleotidos codificam um AA) podemos prever qual a proteína codificada.


  • A sequência apresentada codifica alguma proteína?

Usando o código genético standard obtemos 6 resultados diferentes(pois depende da grelha de leitura usada, e do sentido de leitura(5' para 3' ou de 3' para 5') 5'3' Frame 2 Stop H Y R G V L F L P E S L I F A A R C Stop A A R K A R L N R Q S P V H R Stop R Stop S R V S S Met L F P A K I S V K Met P Stop R Stop C T G S I K R D T K P

5'3' Frame 3 D T T E V Y Y F Y P S R Stop F L P Q G A K P R G K R G Stop T G S R P S T G D G D P A Stop A A C Y F P Q R Y Q Stop K C P E G N V Q A Q Stop S G I R S L

3'5' Frame 1 P G F V S R F I E P V H Y L Q G I F T D I F A G N S Met L L T R D H R H L W T G D C L F S L A F L A A Stop H L A A K I S D S G K N S T P R Stop C Q

3'5' Frame 2 Q A S Y P A L L S L Y I T F R A F S L I S L R E I A C C S R G I T V T C G R A T A C S A S L S S R L S T L R Q K L A T R V K I V H L G S V

3'5' Frame 3 R L R I P L Y Stop A C T L P S G H F H Stop Y L C G K Stop H A A H A G S P S P V D G R L P V Q P R F P R G L A P C G K N Stop R L G Stop K Stop Y T S V V S

Quando não há presença de um codão de iniciação não significa que não exista a sequência de uma proteína, pois sendo esta sequência muito curta esta pode não representar a sequência completa da proteína.

  • Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana?

Para além do codão de iniciação AUG(igual ao do código standard) a variante bacteriana apresenta também como codões de iniciação GUG, UUG, CUG e AUU o que permite uma maior probabilidade de existência de sequências peptidicas.

  • Como poderia saber de que organismo provém esta sequência?

Usar uma ferramenta de alinhamento como o BLAST.


Conceitos a ter no final desta aula:

Estrutura do DNA e RNA

Região 5’ e 3’

Sequência complementar e complemento reverso

Transcrição, direcção da transcrição

Quadro de leitura, quadro de leitura aberto, código genético
Personal tools