BISC 219: Mod 2 Lab 7

Scoring RNAi Worms, Single Worm PCR and Agarose Gel Electrophoresis

3 days before next lab:

1. Come into lab and find your stack of plates.
2. On 2 of the experimental plates add 2 L4 wild type (N2) hermaphrodites
3. On 2 of the experimental plates add 2 L4 rrf-3 hermaphrodites
4. On 1 of the control plates add 2 L4 wild type (N2) hermaphrodites
5. On 1 of the control plates add 2 L4 rrf-3 hermaphrodites
6. Wrap all of your plates in an elastic and stick in your lab day box in the worm incubator set at 23°C
   

Phenotypic Analysis

Today in lab you will examine your RNAi worms and their progeny.

1. Remove your plates from the incubator.
2. Examine your wild type (N2) and rrf-3 RNAi worms. Do you see any difference between the two strains of worms?
3. Compare your RNAi worms to the control worms - are they the same phenotype? Different?
4. Compare your RNAi worms to worms that have a known mutation in that gene - how do the compare?
5. Score and count approximately 50 worms per plate. What is the proportion of affected to unaffected worms?

Be sure to record all of your results in your lab notebook.

C. elegans PCR

How do you know that RNAi is truly degrading just the RNA specific to the genes we are investigating? Might RNAi have some effect on the DNA and thus allowing us to see a mutant phenotype? How might we address this issue? One way is through polymerase chain reaction (PCR) of the gene of interest and sequencing - to compare the DNA of the RNAi worms to the DNA of wild type and mutant worms.

Another amazing thing about C. elegans is we can obtain enough genomic DNA from just 2-3 worms to do a PCR reaction. Today you will isolate genomic DNA from both your RNAi worms and mutant worms and then PCR your gene of interest.

Genomic DNA Protocol Before we can do the PCR reaction we need to lyse the cells of the worm to release their genomic DNA. The hard cuticle surrounding the worms that provides them shape and protection from the outside world makes this slightly challenging. We need to "freeze crack" their cuticle and then digest the cuticle, extra-cellular matrix proteins, and cellular enzymes like DNases with Proteinase K.

1. Obtain two PCR tubes of your team color containing 10 ul of 1X PCR buffer containing 1 μg/μL Proteinase K each.
2. Label one tube A and the other tube B
3. Pick 3 of your L4 or Adult RNAi worms expressing the phenotype of interest and put into Tube A.
4. Pick 3 of your L4 or Adult mutant worms expressing the phenotype of interst and put into Tube B.
5. Bring your tubes to your instructor and the tubes will be frozen at -80°C for 10-15 minutes to "freeze crack" the worm cuticle.
6. Quickly thaw the tubes in your hand and then place them in the PCR machine for the Proteinase K digestion

The "freeze cracked" worms are then heated to 65°C for 1 hour to allow for proteinase K digestion. Then the worm lysate is heated to 95°C for 15 minutes to deactivate the proteinase K. Samples can then be frozen for later use - or PCR can be done immediately.

C. elegans PCR:
When the Proteinase K digestion is complete you will add 40 ul of gene specific PCR master mix to each of your 2 tubes. Each master mix includes:

     36 μL of 1x PCR buffer (10 mM Tris, 50 mM KCl, 1.5 mM MgCl₂ pH 8.3)
      1 μL of 100 mM dNTPs (25 mM of each dNTP)
      1 μL of forward primer (20 μM stock)
      1 μL of reverse primer (20 μM stock)
      1 μL of 5 units/μL Taq Polymerase
Total PCR reaction volume = 50 μL (10 μL genomic DNA prep + 40 μL PCR Master Mix

Primer sequences:

Gene name	Forward Primer	Reverse Primer
egl-13	5' GGGACAAATTATGGAAGCGATGGTC 3'	5' CAGCTGTTTGTAGGAGATGTG 3'
lon-3	5' ATGTCGGTCACTACGGCCACATC 3'	5' GGTCCGGCAGATCCTTGGTATCCTGG 3'
dpy-13	5' AGTCGTCTTCTCCGTTATCG 3'	5' GAGCAACGCATAAGGCAAAG 3'

PCR Conditions:

Step	Temperature	Time	Repeat
1	94°C	2 minutes	1 time
2	94°C	30 seconds
3	54°C	30 seconds
4	72°C	2 minutes	Steps 2-4 30 times total
5	72°C	10 minutes	1 time
6	4°C	forever	end program

Agarose gel electrophoresis of PCR product:
(NOTE: Because of the length of time it takes to digest the worms and run the PCR - gels will be run by the instructors for this series.)
Prepare a sample for electrophoresis by loading 10 μL of your PCR product with 1-2 μL of loading dye on a 1.0% agarose gel with SybrSafe™ stain. Run the gel at 100V for 45 minutes to an hour. The gel will be photographed using UV light and the photo posted to the lab conference.

RNAi Schedule of Experiments
RNAi General Information
Media Recipes
Lab 4: Picking your gene to RNAi
Lab 5: Plasmid DNA isolation and transformation
Lab 6: Induction of RNAi plasmid and C. elegans feeding
Lab 8: PCR Reaction Cleanup and Sequencing