BME100 f2013:W1200 Group16 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY: Polly Name: Rene Reynolds Name: Mychal Hooser Name: Ayanna Akinyemi Name: John Jakoubek Name: Courtney Willson LAB 6 WRITE-UP Computer-Aided Design TinkerCAD Tinkercad is a program that can be used to build 3D models. In lab we found the Tinkercad file of the eppendorf or PCR tubes and changed it to our own way. What our group did was connected all the tubes together so they wouldn't get lost as easily and are easier to carry and move around all at once. Also, we changed the way the lid closes to make it a better sealed container and it allows only the tip of the pipet into the tube, minimizing the ability for the solution to be contaminated. Lastly, we changed some of the colors of the original tube design to add our own personal touch. Implications of Using TinkerCAD for Design TinkerCAD can be used for many things in the world of engineering. However, some of its most practical uses come in handy when trying to design the smaller plastic pieces on demand in lab. As mentioned above, TinkerCAD can be effectively used to enhance previous eppendorfs to make them more user-friendly. Adding measurements to the tubes as well as connecting them enhances the design. Also, on TinkerCAD it is possible to add letters and numbers to a design, so an alpha-numeric grid system could be placed on the outside holder to confirm which tube is next to be pipetted. (In example : A1, A2, A3, etc...). This will ultimately diffuse any confusion the user may have about where to pipette from. TinkerCAD makes enhancing problematic defects much easier and convenient. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Nucleotides are essentially the building blocks of DNA and RNA. They are composed of a sugar molecule, a phosphate group, and a nucleic base. In DNA, the sugar molecule is deoxyribose and the purine bases include adenine and guanine while the pyrimidine bases include thymine and cytosine. In RNA, the sugar molecule is ribose and the purine bases include adenine and guanine while the pyrimidine bases include cytosine and uracil (instead of thymine). Polymorphism is when there are two or more differences between two of the same DNA sequences. The rs17879961 variation is only found in homosapiens and the clinical significance of this single nucleotide polymorphism (SNP) is pathogenic. The SNP rs17879961 is on chromosome number 22 out of the 23 chromosomes that humans typically have, indicating where the polymorphism occurs. The affected gene in SNP rs17879961 is Kinase 2. The reason why the SNP occurs here is because there is damage to the DNA or stoppage in replication forcing the cell cycle regulators to halt the cell cycle. Primer design Forward Primer: TGTAAGGACAGGACAAATTT Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC Primers are made to specifically focus on a certain segment of the DNA sequence, and in this case the primers are made specifically for the SNP rs17879961 Feature 2: Consumables Kit Our consumables kit will contain eppendorfs with a cap that will allow the tip of the pipette to draw as much fluid as desired by the user. Also, our kit is going to contain an organization apparatus that somewhat resembles a fishing tackle-box. The foldable shelves will ensure that the primers, tips, tubes, PCR mix, and micropipettor are not only separated in an orderly fashion, but securely fastened to ensure that nothing gets lost,broken, or contaminated. These measures will ultimately solve the contamination problem and fix the previous design flaws. Feature 3: PCR Machine Hardware The OpenPCR design was well made. We would use this same design, with a few alterations. First, the software is kind of redundant. We would make it so that the cycle times and temperatures were already preset, so the user would not have to manually set them. All the user would have to do is insert the DNA, close the lid, and hit start. The second alteration would be to decrease the amount of time that it takes to run a cycle. To do this, our PCR machine will insert nanobots into the DNA mixture, whose job would be to aid in the separation of the DNA strands and binding them to the primers. Feature 4: Fluorimeter Hardware The biggest issue our group had was keeping the distance between the camera and the droplet the same for every picture. To improve this, our fluorimeter would have several upgrades. First, there would be a camera that would come with it, standard for all purchases. This would increase the cost of the package, but it would be more helpful to the consumer. This is because to fix the distance issue, the camera would be attached to an adjustable stand that is connected directly to the fluorimeter. The stand could then be slid out from the base, and the slide would have a ruler on it so that it would tell the user the exact distance from the camera to the droplet, which would make it easier to keep the distance uniform throughout the entire process. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach Calculation 3 is determining the probability that a patient will develop cancer, given that his/her DNA sequence has the cancer gene. The value from this calculation was very small, meaning that it is not accurate. Calculation 4 is determining the probability that a patient will not develop cancer, given his/her DNA sequence does not have the cancer gene. The value from this calculation was less than one, meaning that it was not accurate. The calculations show that the CHEK2 PCR was not very accurate for predicting cancer. The values should be close to one to be accurate. Calculation 4 was close, but not close enough. This is not necessarily due to bad equipment, but most likely due to human error, such as bad pictures for analyzing, not preparing the samples for PCR correctly, etc.