BME100 f2013:W1200 Group6 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Jenny Chen Tracy Lopez Nayobe Bivins Alex Bugarin Nicholas Kilpatrick LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is an online site that allows the user to create 3D designs easily. By combining and manipulation basic shapes, any design can be created. There are special tools and shapes that allow the user to create precise details. Once designed, it can be sent to a 3D printer to get a physical model by using a standard STL file. We used TinkerCAD to modify a set of tubes used in PCR. The tubes were modified to include thin rubber strips around each tube for easier gripping. This would prevent slipping while handling the tubes. The tubes are also labelled in order to help with tube identification. The back of the rubber strip was left blank so that you could label with additional information if needed.The label is thin and fits tightly around the tube, meaning that it remains a standard size and can still be used with all the necessary equipment. Implications of using TinkerCAD for design One possible redesign of the OpenPCR machine would be to design a better camera holder. We had a lot of difficulty keeping the camera in one place. It was very easy to bump it and then everything would have to be set up again. Even a slight variation in the distance between the camera and the fluorimeter would change the image making it difficult analyze accurately in imageJ. Using TinkerCAD, one can attach the camera holder to the fluorimeter. This attachment will be adjustable to allow the camera holder to be placed in the correct position to focus, making it adaptable to all phone models. Once in the correct position, a knob would hold the assembly in place so that the camera holder would stay in place, reducing the chance of error. TinkerCAD is useful in designing prototypes to be tested before having to manufacture a product on a more massive scale. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Carbohydrates, proteins, and lipids form the central structure of the working part of most cells. However, they do not have control over the operation of the cells. This responsibility is done by four main groups of biological molecules called nucleic acids. The dsDNA (double-stranded deoxyribonucleic acid) is responsible for carrying, encoding, and passing the genetic information from one generation to another. The dsDNA is classified as a polymer; that is, it is made up of subunits (called monomers) joined together to make larger molecules. The monomers that make up the dsDNA are called the nucleotides. A nucleotide is made up of three components that are linked together: a phosphate group, a five-carbon sugar molecule (this differentiates dsDNA from the single-stranded RNA), and a nitrogen base (adenine, thymine, guanine, and cytosine). The base pairing of the nucleotides are always complementary. This means that adenine (A) will only pair with thymine (T), and guanine (G) will only bind with cytosine (C). For example, if the DNA sequence of the leading strand is AGCTTGGTACCAGC, then the DNA sequence of the complementary strand should be TCGAACCATGGTCG. For this reason, they dictate the order of the nucleotides being synthesized on the new DNA strand during the replication process. A genome is an organism's entire genetic makeup. The human genome is composed of billions of base pairs. When the genome is copied to make a new cell it is not always perfect because a single base pair may: get deleted, added, or substituted. An example of this is when one DNA sequence is CTAAGTA and the other DNA sequence is CTAGGTA (this sequence should be CTAAGTA). The two DNA sequences seem identical; however, they differ at one nucleotide position. Variation or mutation in a single base pair creates a single nucleotide polymorphism (SNP). Our DNA is actually made up of millions of SNPs; this accounts for the many differences (e.g. physical characteristics, development of diseases or our systems’ response to pharmaceutical drugs) we have to each other. Furthermore, the SNP rs17879961 is linked to a high risk of cancers to homo sapiens. It commonly occurs on chromosome number 22 with a clinical significance of a pathogenic allele (i.e. it is in the human gene checkpoint kinase 2 or also called CHEK2). The CHEK2 gene provides codes for making proteins called checkpoint kinase 2. Checkpoint kinase 2 is stimulated when the dsDNA is damaged for whatever reason (e.g. disturbance of homeostasis). Ultimately, it acts as a tumor suppressor by inhibiting cancer cells from rapidly dividing and affecting healthy cells. Primer design Forward Primer: 5' - TGTAAGGACAGGACAAATTT Cancer-specific Reverse Primer: 5' - TGGGTCCTAAAAACTCTTAC How the primers work: With the patient’s sample in the solution, the reverse primer will bind to the complementary cancer-SNP template. The reverse primer will only bind to its complementary sequence. The reverse primer and the complementary sequence must match or it will not bind. The forward primer acts in the same manner. It will only bind if it matches its complementary sequence. If either primer does not match the sequence completely, it will not bind at all. If it does not match, then it will not replicate. Therefore, only the DNA with the cancer-associated SNP will be replicated. Any DNA containing the non-cancer allele will not be replicated. In this lab, the primers will amplify only the DNA that contains the cancer-associated SNP rs17879961. Feature 2: Consumables Kit We will use a cardboard box with a styrofoam block inside to safely protect the materials. The micropipette, primer and mix will be held in place so that it will not move during packaging. Also, there will be plastic baggies to hold the tubes so that the kit is neatly organized and nothing gets mixed around. On the side of the styrofoam box will be the instructions manual. The outside of the box will have pictures that will demonstrate its uses and make it look professional.The logo and slogan will also be displayed on the outside of the box in a prominent position. Weaknesses in the last kit was that the SYBR green dye kept going faulty. The SYBR green dye needs to be kept out of the light so that it doesn't get bleached and become ineffective. We made the SYBR green tubes black so that light will not degrade the dye. Another weakness was the labeling of the microtubes. We made the tubes better by adding labels to the side of the tubes. These labels not only identified the tubes, but also used as a grip so it does not fall from your fingertips on accident. Feature 3: PCR Machine Hardware The PCR machine is improved and will be able to test more samples at once. The machine will run more smoothly and will be able to run cycles simultaneously on the open PCR program. This will make the machine more time efficient and it will allow hospitals to do more tests at once for a high demand of samples. A weakness when using the open PCR machine is that it was not fast enough and that it did not do enough PCR tests at once. Also, it only took 16 samples for 2 hours. So what we decided to do was to add more sample holders on the machine. We accomplished this by making a double open PCR machine that can hold two separate sets of samples. This way the machine will be doing double the work in only half of the time. This can also help separating your samples. Next, the machine had to be connected to a computer to access the information on the PCR Machine. To fix that we added a USB port. A USB flash drive can be plugged in directly to the PCR machine. When the machine says complete on the LED screen, all information is transferred onto the flash drive. This flash drive can be plugged into any computer to have the information readily available. Feature 4: Fluorimeter Hardware The fluorimeter will use its same methods when its incorporated in the system design. It will still detect DNA in the our system and transmit light that will detect a fluorescence for a concentration of DNA. Adding grips and connecting the cradle to the fluorimeter box will make the device easier to use and more accurate when collecting data. First, the entire bottom of the fluorimeter will be fitted with a material that serves as a grip. This will prevent the box from moving easily reducing error. It will also have an additional adjustable plate that will connect from the fluorimeter box to the cradle that holds the phone. This will help with the problem of having to adjust the distance every time the Fluorimeter is used with the same phone. Also there will be an app on the apple or android market specifically for the Fluorimeter Hardware. The app will have a camera application and when it is opened it will be set to the most optimized setting for taking pictures of the DNA. When the pictures are taken they can be automatically uploaded wirelessly to the computer ready for imageJ. This will reduce the time of uploading photos and making the Fluorimeter more efficient. Weaknesses: 1. The Fluorimeter was not very stable when adjusting the slides because it moved very easily. 2. It was tedious and took too long to analyze the data. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach Calculation 3 gives the probability that a patient will develop cancer, given a cancerous DNA sequence. Our result from calculation 3 was very small. This implies that the CHEK2 PCR is not accurate. It is unable to predict if a patient possessing the cancerous DNA sequence will develop cancer. The PCR analysis will generally not return a positive result from cancerous DNA. Calculation 4 tests specificity. It analyzes the probability that the patient will not develop cancer, given a non-cancer DNA sequence. Our result from calculation 4 was larger than calculation 3, but still not close to 1. So, a non-cancerous DNA would often still return a positive result.