BME100 f2013:W1200 Group8 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
Perfect PCR Name: Colby Mark - Analysis Specialist Name: Andrew Wills - Experimental Specialist Name: Madison Grayson - Data and Procedure Specialist Name: Hayden McIver - Experimental Specialist Name: Isai Valdez - Research Specialist [Perfect PCR] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD We first went to the tinkerCad website and practiced different methods used for manipulating objects in the program. Then the group opened up the file named "Fantastic Habbi BME 100," and started improving upon the small PCR tubes. The team also modified the tubes so that they were differentiable by color, name plates on the lids to allow for easier labeling, and created snap and unsnap pieces to connect the small tubes. This allowed for easily grouping certain tubes, and allows them to stand straight up. Implications of Using TinkerCAD for Design There are many ways to use TinkerCad for designing something practical. For example, the design program can be used to create many of tthe smaller plastic items that are used in the lab. They PCR tubes could be modified by making them a different color, or by changing their size to allow for more mL of a solution to be put inside them. The program can also be used to create a well plate, and can design it to accomodate for specifics for the user. The well plates can be made deeper or wider, or labels can be put on to make organization of solutions or liquids easier. Since TinkerCad is compatible with 3D Printers, it is a very convenient way to design products and print the actual model for production without the use of a company or factory. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation A Nucelotide is a building block of nucleic acids. Many of these nucleotides bond together to form these nucleic acids. A polymorphism is commonly known as a variance in a specific sequence of the DNA. SNP, or Single Nucleotide Polymorphism is the difference in a single nucleotide of a person or organism. rs17879961 is an SNP. This causes a mutation in humans or "homosapiens," that is related to cancer and it is extremely pathogenic. This SNP is located on the 22nd chromosome in humans, and affects a specific gene called the CHEK2 protien. This is short for checkpoint kinase 2, and when there is no mutation, this gene regulates cell production in the body. When there is a mutation in this gene the cells start to divide uncontrollably, which causes cancer or tumors. Primer design Forward Primer: 5' - ACTCACTTAAACCATATTCT Cancer-specific Reverse Primer: 5'-ACATTCTCAAAAATCCTGGC How the primers work: The reverse primer will bind to a complementary cancer SNP containing template that was taken from a patients sample. The reverse primer binds only to the complementary sequence if its matches that sequence with 100% accuracy. The forward primer is the same, it will only bind to its complement if it is a 100% match. If the primer does not match the sequence it won't be replicated during the process. Because of this, only the DNA with the cancer SNP will be replicated. All other DNA that has non-cancer alleles will not be replicated. This is why the primers will amplify DNA that contains only the cancer-associated SNP rs17879961 and will not amplify DNA that has the non-cancer allele. Feature 2: Consumables Kit The tips could be stacked so that more can be available in the kit, minimize the space needed for the tips by condensing the packaging of tips. The holder for the PCR mix can be made more efficient, by having space to label. The ejection velocity of the tips put on the pipette was too fast. The chemicals that are still contained in the tips, even though it is very minuscule, could be distributed to the surroundings in a harmful manner. The micropipettor could come in small pieces that can be assembled upon the opening of the kit, instead of being whole to start with, this would allow for a different sized micropipette metal tip to come with the product. The consumables packaging plan adresses some of the major weaknesses that were experienced during the lab. There were alot of waste products because of using so many plastic pipette tips. The PCR mix tubes need a holder otherwise the contents would accumulate on the side because it would have to be laid down. Along with these weaknesses, there was a problem with disposing of the pipette plastic tips. When ejecting them from the MicroPipettor, they would fly off into the plastic waste container with such a higher velocity, that they would occasionally bounce out. Maybe by including a metal tip for the micropipette that didn't have as much friction with the plastic tips in the kit, it would eliminate this problem. Feature 3: PCR Machine Hardware In our system the PCR machine will be included to replicate the targeted DNA in samples, much like how it was used in our lab. We will take the original DNA sample, add PCR reaction mix and put it in the PCR machine so that the targeted DNA strand is replicated enough to were a logical conclusion could be made of whether the patient has the mutation or not. The machine we used seem to perform well and we would not like to make any changes to perfect it's preformance, however there were many other machines that did not work, so making them somehow more reliable would be important. We would like to redesign the tubes that are used in the PCR machine to make them easier to use. We liked the eco-friendly design of the PCR system as well as it's compact assembly. By producing the machine in parts and allowing the consumer to put it together, we saved space in shipping as well as indirectly giving the consumer some mechanical knowledge of the machine. We also noticed that there were many pores for test tubes in the machine. For us this was helpful since we were working with other teams, however what if only a few tests had to be made? We would propose that the amount of test tube pores actively heating and cooling the samples should be able to be altered for what is needed in order to be more efficient in time and power. This would be added to an option on the computer-operated part of the machine. Further more, by isolating (creating a barrier between) each heating/cooling pore of the machine, we could individualize the reaction in order to preform multiple experiments at a time. Considering this process is very time consuming, this would dramatically reduce the time needed for someone who required seperate settings for their experiments. Feature 4: Fluorimeter Hardware The Fluorimeter was included in the system by creating a set up in which a glass slide was placed in between the terminals and a drop of our sample was placed so that the light beam would shine through it. The phone of choice was placed on a stand 7cm away from the sample and a picture was taken of the light shining through the sample in a dark environment created by a box placed over the system. The Fluorimeter was used to determine the fluorescence emission, and the absorbance from the sample. One change that could be made to Fluorimeter system would be to make it so the phone stand it attached to the base of the actual Fluorimeter so there will be a constant distance the picture is taken at every time. Some times when the button was pressed to take the picture, the phone holder would slide forward a little bit, or the angle of the phone in the holder would change causing different perspectives in the pictures. The phone stand should be connected to the Fluorimeter and the phone should be secured within the stand Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]