BME100 f2013:W900 Group10 L6

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Feature 1: Cancer SNP-Specific Primers)
(Feature 1: Cancer SNP-Specific Primers)
Line 62: Line 62:
How the primers work: ''[Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.]''
How the primers work: ''[Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.]''
A DNA primer is a short strand of nucleotides (usually about 20 nucleotides) that is complementary to a region on a template DNA strand. Because DNA will naturally bind to complementary strands, the primer attaches itself to the region on the DNA strand to which it is complementary. In general, a 20 nucleotide-long DNA strand will only match a single region (or no region) on a DNA strand, and will thus consistently bind only to that region. However, primers that are less than 20 nucleotides long run the risk of matching more than one sequence on the template DNA strand. This is important because we use primers to "block out" a region on the DNA strand we wish to amplify. Because a primer can only bind to a template DNA strand that contains its exact complement, we can take advantage of this in PCR when we are looking for a SNP. If we create a primer that is a complement of a region of DNA with a known SNP, the primer will ONLY BIND to a template strand that contains this SNP. Furthermore, because PCR cannot function unless primers attaches the DNA template strands, we can use this to determine if an SNP is present in a given template strand. If a PCR reaction containing a template DNA strand and a primer with the complement of a cancer-associated SNP greatly amplifies this region we can conclude that this template strand contains the cancer-associated SNP. If there is little or no amplification we can conclude that our primers did not attach properly, indicated that the cancer-associated SNP is not present on our template strand.

Revision as of 20:13, 23 November 2013

BME 100 Fall 2013 Home
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Wiki Editing Help



Name: Barrett Anderies
Name: Barrett Anderies
Name: Joslin Jose
Name: Joslin Jose
Name: Liam Williams
Name: Liam Williams
Name: Duran Charles
Name: Duran Charles


Computer-Aided Design


[Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th]

We used the 3D CAD software TinkerCAD to modify the given PCR tube CAD file. We added liking structural members between all of the tubes to make them into a single unit. This makes them more convenient to fill and transport. Furthermore, we modified the directions the lids open. This minimizes the area the tube array takes up when the lids are open.

[Instructions: Show an image of your TinkerCAD PCR tube design here]

Image: BME100_Group_10_PCR_tubes.png

Implications of Using TinkerCAD for Design

[Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.]

CAD software, like TinkerCAD, is essential for rapid product design and prototyping. An example of this would be modifying the OpenPCR machine to hold 32 tubes rather than just 16. This would required a different PCR block that would take up more space than the original block. With CAD software, we can design a new PCR block and corresponding heating element and add it to the current CAD model of the OpenPCR machine. This way we can check to see if our design will fit in the current machine and what other modifications we will need to make to accommodate our additions. After confirming that our design is viable, we can 3D print the parts we modified and add them to a current OpenPCR machine to practice assembly and display our design to interested parties (investors, etc.) without actually going into production.

Feature 1: Cancer SNP-Specific Primers

[Instructions: This information will come from the Week 9 exercises you did in lab. Your notes should be in a pdf file that is saved on Blackboard under your group.]

Background on the cancer-associated mutation

[Instructions: Use the answers from questions 3, 4, 5, and 7 to compose, in your own words, a paragraph about rs17879961]

DNA, deoxyribonucleic acid, is a polymer composed of the nucleotides (monomers) Adenine, Guanine, Cytosine and Thymine. The arrangement of these nucleotides in DNA encodes the genetic instructions that facilitates the development and operation of all organisms on earth. Since an organism is dependent upon its DNA for proper functioning, deleterious mutations in DNA can have serious consequences. One such mutation is a single nucleotide polymorphism, or SNP, where a single nucleotide is replaced by another (and as a result it corresponding nucleotide on the the other DNA strand). For example and Adenine is replaced by Cytosine (in which case the corresponding nucleotide on the other strand would go from Thymine to Guanine). In many cases a SNP will not cause any significant change in an organism's phenotype, but one instance where this does occur is an SNP of rs17879961 in chromosome 22 in humans. rs17879961 is in a gene that produces CHEK2 (checkpoint kinase 2), a tumor suppressor gene. When an SNP occurs at rs17879961 CHEK2 does not operate correctly. This greatly increases the risk of cancer in an affected individual.

Primer design

  • Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC

How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.]

A DNA primer is a short strand of nucleotides (usually about 20 nucleotides) that is complementary to a region on a template DNA strand. Because DNA will naturally bind to complementary strands, the primer attaches itself to the region on the DNA strand to which it is complementary. In general, a 20 nucleotide-long DNA strand will only match a single region (or no region) on a DNA strand, and will thus consistently bind only to that region. However, primers that are less than 20 nucleotides long run the risk of matching more than one sequence on the template DNA strand. This is important because we use primers to "block out" a region on the DNA strand we wish to amplify. Because a primer can only bind to a template DNA strand that contains its exact complement, we can take advantage of this in PCR when we are looking for a SNP. If we create a primer that is a complement of a region of DNA with a known SNP, the primer will ONLY BIND to a template strand that contains this SNP. Furthermore, because PCR cannot function unless primers attaches the DNA template strands, we can use this to determine if an SNP is present in a given template strand. If a PCR reaction containing a template DNA strand and a primer with the complement of a cancer-associated SNP greatly amplifies this region we can conclude that this template strand contains the cancer-associated SNP. If there is little or no amplification we can conclude that our primers did not attach properly, indicated that the cancer-associated SNP is not present on our template strand.

Feature 2: Consumables Kit

[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]

[Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]

Feature 3: PCR Machine Hardware

[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]

[Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]

Feature 4: Fluorimeter Hardware

[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.]

[Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]

Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]

Personal tools