BME100 f2013:W900 Group14 L6: Difference between revisions
Austin Davis (talk | contribs) |
Austin Davis (talk | contribs) |
||
Line 51: | Line 51: | ||
'''Primer design'''<br> | '''Primer design'''<br> | ||
* Forward Primer: '' | * Forward Primer: ''ACTCACTTAAACCATATTCT'' | ||
* Cancer-specific Reverse Primer: '' | * Cancer-specific Reverse Primer: ''GGTCCTAAAAACTCTTACAC'' | ||
How the primers work: <br> | How the primers work: <br> |
Revision as of 08:53, 27 November 2013
BME 100 Fall 2013 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | ||||
OUR COMPANY
PCR Beginnings LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD The tinkerCAD tool is an online modeling program that allows the user to depict physical concepts in 3 dimensional space. These concepts can then be printed using a 3D printer. We used the program to imagine modifications to the PCR tubes used in the OpenPCR. The tubes we designed were all connected for more efficient transportation of the tubes. The modified tubes also had indicated labeling sites on each tube to remind the user that they should label their tubes for sake of better organization.
It is very easy to use TinkerCAD to design practical items. A camera holder for the lab would be a perfect example of an item that needs to be redesigned on TinkerCAD. It has a simple rectangular shape and would be easy to mold on the design website. This apparatus was chosen because it failed multiple times throughout the lab. The smartphones used in the lab were too top-heavy to be held with the existing camera holder, so a more stable design for the holder is needed. The design on TinkerCAD could have a completely altered shape, or just one side of the camera rack could be extended to prevent the camera from falling. A simple edit to the design of a camera holder on TinkerCAD would greatly improve the results in the lab. Feature 1: Cancer SNP-Specific PrimersBackground on the cancer-associated mutation The SNP rs17879961 is a pathogenic variation of the CHEK2 gene in humans, it is one of 25 SNPs associated with a high risk of breast cancer, as well as one of three SNPs that are closely associated with a risk of lung cancer, especially as brought on by tobacco use. It most commonly appears on the 22nd of the 23 pairs of chromosomes in humans, as causes an inhibition in CDC25C phosphotase, interfering with the mitosis stabilizing protein, p53, which results in an interruption of the cell cycle.
Primer design
How the primers work:
Feature 2: Consumables KitThe consumables will be packaged with all of the kit's necessary components. Included will be PCR tubes in a sealed container, a separate holder for the PCR tubes, the PCR mix, a micropipet with extra tips, sample solutions for micropipetting practice and an instruction manual. The packaging plan addresses that students using the micropipets may have little to no experience, so extra micropipet tips and practice solutions are provided. The instruction manual would have separate instructions for the practice solutions. The solution in the PCR tube would change to a certain color when the correct volumes of two solutions were combined. This would allow students to check their micropipetting work before they begin the lab. This is an example of how our consumables kit would be packaged. Our kit would have an additional manual and small bottles of solutions. Feature 3: PCR Machine Hardwarehttp://openwetware.org/images/thumb/e/ef/HALEY.png/562px-HALEY.png
Feature 4: Fluorimeter HardwareThe fluorimeter operates by subjecting a liquid sample containing a fluorescent agent to very mild ultra-violet radiation, activating the fluorescent agent to produce a visible light, indicating its presence and activation. Such agents, particularly SYBR Green require the presence of complete strands of DNA, containing both halves of the double helix so it can bond to these molecules and be subsequently activated. It will come pre-assembled with the package, and provide a convenient means of determining whether or not one possesses the gene of interest.
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.] |