BME100 f2013:W900 Group17 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Abrar Bakhsh Name: Jeremy Becker Name: Luis Hernandez Name: Alison Llave Name: Naaz Maududi J-LAN Care with the new and improved Diagnostic OpenPCR kit LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a computer aided design program freely available online that enables users to create or edit basic 3D models which can then be exported to a 3D printer. TinkerCAD offers a simple interface, an easy learning curve, along with a series of tutorials so that someone with limited to no design software experience can still use it effectively. For this experiment, the software was used to improve the design and function of a pre-made model of 8 PCR tubes. ID numbers were added to the individual tubes' lids. This no longer requires the individual labeling of the small tubes by hand and instead allows the simple recording of the ID number and subsequent contents of the tube to be recorded onto a separate list or Excel sheet for example. A separate device, a lid, was designed to cover the tubes to prevent light from reaching them while still allowing easy access. The two designs are shown below. Implications of Using TinkerCAD for Design Due to TinkerCAD's ease of use and ability to manipulate 3D objects, it could be used to design or redesign one-piece objects or multiple parts to be assembled later. The program could be used to redesign the camera holder used in this experiment. The dimensions of the 3D model could be manipulated to better fit a certain model of phone or camera. It could also be redesigned to place the phone or camera higher or lower in space. In addition, material could be added to provide a more stable base to prevent the platform from moving between pictures. For the same purpose, some type of simple adjustable yet locking attachment device or arm could be designed into the camera holder to allow it to attach to the fluorimeter, the table, or the light box. This would reduce the difficulty in keeping the camera the same distance from the fluorimeter for each picture. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Rs17879961 is a pathogenic mutation found on the 22nd chromosome of the 23 chromosomes. Rs17879961 affects the gene Checkpoint Kinase 2, this gene normally produces a protein which functions in tumor suppression. Primer design Forward Primer: 'ACTCACTTAAACCATATTCT Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC How the primers work: A primer begins with identifying a target sequence which in this case is RS1789961. The primers will bind to the 3'end of the target sequence, and that sequence must be complementary to the sequence of the primer. After the binding of the primer, DNA polymerase will synthesize the complimentary DNA strand. DNA with the target sequence will be copied because DNA polymerase can only copy the sequence with primers attached to them. Due to this fact, non cancerous alleles will not be copied or amplified. This process is repeated until the gene of interest is extended, in other words there will be a large amount of target sequence molecules that only code for Rs17879961, which is a cancer associated marker. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] In this new diagnostic system, the consumables kit will be packaged efficiently by first packing the arrangement of items itself efficiently. This will generally be accomplished with the method in which the tips for the micropipettor are packaged as these are packaged in a pattern of orderly rows in neat layers one top of another. This method will allow for the best use of space, especially when packaging the tubes. Also, the PCR mix and Primers within their containers can also be packaged in this condensed space once properly labelled. hgh [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] The system will of course include an OpenPCR machine which, while similar to the machine regularly used today, will include some key improvements. [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] An improved fluorimeter will be included in this kit which features [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]