BME100 f2013:W900 Group17 L6

From OpenWetWare
Jump to navigationJump to search
BME 100 Fall 2013 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR COMPANY

Name: Abrar Bakhsh
Name: Jeremy Becker
Name: Luis Hernandez
Name: Alison Llave
Name: Naaz Maududi


[Instructions: add the name of your team's company and/or product here]


LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

[Instructions: A short summary (up to five sentences) of the TinkerCAD tool and how you used it in lab on November 20th]

[Instructions: Show an image of your TinkerCAD PCR tube design here]


Implications of Using TinkerCAD for Design

[Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.]



Feature 1: Cancer SNP-Specific Primers

Background on the cancer-associated mutation

Rs17879961 is a pathogenic mutation found on the 22nd chromosome of the 23 chromosomes. Rs17879961 affects the gene Checkpoint Kinase 2, this gene normally produces a protein which functions in tumor suppression.


Primer design

  • Forward Primer: 'ACTCACTTAAACCATATTCT
  • Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC

How the primers work:

A primer begins with identifying a target sequence which in this case is RS1789961. The primers will bind to the 3'end of the target sequence, and that sequence must be complementary to the sequence of the primer. After the binding of the primer, DNA polymerase will synthesize the complimentary DNA strand. DNA with the target sequence will be copied because DNA polymerase can only copy the sequence with primers attached to them. Due to this fact, non cancerous alleles will not be copied or amplified. This process is repeated until the gene of interest is extended, in other words there will be a large amount of target sequence molecules that only code for Rs17879961, which is a cancer associated marker.



Feature 2: Consumables Kit

[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]

[Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]



Feature 3: PCR Machine Hardware

[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]

[Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]


Feature 4: Fluorimeter Hardware

[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.]

[Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]