BME100 f2013:W900 Group17 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Abrar Bakhsh Name: Jeremy Becker Name: Luis Hernandez Name: Alison Llave Name: Naaz Maududi J-LAN Care with the new and improved Diagnostic OpenPCR kit LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a computer aided design program freely available online that enables users to create or edit basic 3D models which can then be exported to a 3D printer. TinkerCAD offers a simple interface, an easy learning curve, along with a series of tutorials so that someone with limited to no design software experience can still use it effectively. For this experiment, the software was used to improve the design and function of a pre-made model of 8 PCR tubes. ID numbers were added to the individual tubes' lids. This no longer requires the individual labeling of the small tubes by hand and instead allows the simple recording of the ID number and subsequent contents of the tube to be recorded onto a separate list or Excel sheet for example. A separate device, a lid, was designed to cover the tubes to prevent light from reaching them while still allowing easy access. The two designs are shown below. Implications of Using TinkerCAD for Design Due to TinkerCAD's ease of use and ability to manipulate 3D objects, it could be used to design or redesign one-piece objects or multiple parts to be assembled later. The program could be used to redesign the camera holder used in this experiment. The dimensions of the 3D model could be manipulated to better fit a certain model of phone or camera. It could also be redesigned to place the phone or camera higher or lower in space. In addition, material could be added to provide a more stable base to prevent the platform from moving between pictures. For the same purpose, some type of simple adjustable yet locking attachment device or arm could be designed into the camera holder to allow it to attach to the fluorimeter, the table, or the light box. This would reduce the difficulty in keeping the camera the same distance from the fluorimeter for each picture. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Rs17879961 is a pathogenic mutation found on the 22nd chromosome of the 23 chromosomes. Rs17879961 affects the gene Checkpoint Kinase 2, this gene normally produces a protein which functions in tumor suppression. Primer design Forward Primer: 'ACTCACTTAAACCATATTCT Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC How the primers work: A primer begins with identifying a target sequence which in this case is RS1789961. The primers will bind to the 3'end of the target sequence, and that sequence must be complementary to the sequence of the primer. After the binding of the primer, DNA polymerase will synthesize the complimentary DNA strand. DNA with the target sequence will be copied because DNA polymerase can only copy the sequence with primers attached to them. Due to this fact, non cancerous alleles will not be copied or amplified. This process is repeated until the gene of interest is extended, in other words there will be a large amount of target sequence molecules that only code for Rs17879961, which is a cancer associated marker. Feature 2: Consumables Kit ' In this new diagnostic system, the consumables kit will be packaged efficiently by first packing the arrangement of items itself efficiently. This will generally be accomplished with the method in which the tips for the micropipettor are packaged as these are packaged in a pattern of orderly rows in neat layers one top of another. This method will allow for the best use of space, especially when packaging the tubes. Also, the PCR mix and Primers within their containers can also be packaged in this condensed manner once properly labelled. Now because of the condensed way of packing, the boxes in which the consumables are packaged can also be smaller which would allow for savings in space and cost. As for the micropipettor, the current design and regular, minimal packaging would be employed with the exception of an improvement in its ability to take up larger amounts of liquid substance. The SYBR Green substance would also see improvement, but in its packaging instead of design as it would include a convenient aluminum cover so that it may be taken into lighted areas with minimal effect on its later use. With all these improvements, the packaged consumables could conceivably take up only two thirds as much space as they usually do with only four small boxes included for the micropipettor, the tips, the PCR mix, and the primers, with the tubes being included in the later two. This packaging method addresses several major weaknesses described such as the SYBR Green being light sensitive, the tendency for pre-mixes to be swapped, and the measuring error which sometimes occurred when liquid was left over in the tube by the micropipettor. The first of these weaknesses is addressed by the aluminum covering included with the package which allows consumers to conveniently protect their SYBR Green from light exposure. The second of these weaknesses can be fixed through the new kit's use of more effective coloring labels which will promote more awareness of each specific substance. Finally, the last weakness will be addressed by increasing the micropipettors ability to handle bigger volumes of substances. ' Feature 3: PCR Machine Hardware ' The system will of course include an OpenPCR machine which, while similar to the machine regularly used today, will include some key improvements. First, the time to completion will be displayed not only on the computer running the PCR software but also on the small screen attached to the machine itself. This way, it is easier to stay informed. Next, this time to completion will, by a bluetooth feature newly included in the machine, be regularly sent to a user's mobile device through the use of a convenient application. This will allow a PCR machine user to complete other tasks while staying informed about exactly how long the PCR machine has left. In this way, the inconvenience of having uncertainty about the time to completion will be minimized. As for how the PCR can be included in the system, it could be packaged and sold as a separate device or potentially in a bundle, depending on the needs of the consumer. And because OpenPCR machines are very cheap relative to professional devices, they can be easily marketed as much better alternatives for hobbyists or low budget scientists, especially since the name already enjoys a high amount of recognition. This new and improved OpenPCR machine included in the system would address problems including the time consuming reaction length and the inconsistant performance, two issues cited in the virtual board. The first of these problems, the time consuming reaction length, would be indirectly addressed because even though the machine's time to completion would not be shortened, the new notification system would allow for more efficient use of time since a machine user would not need to be present regularly in order to know how much more time a reaction will take. Now the second problem would be addressed in the same way as the first as inconsistant performance would no longer be such a hinderance if waiting time could productively be used elsewhere. However, while this solution is an initial solution to these problems, it is not a full solution and more work could be done to improve these weaknesses of the PCR system. ' Feature 4: Fluorimeter Hardware ' An improved fluorimeter will be included in this kit which will serve the same purpose as in lab, namely, to test whether a whether a sample is positive or negative for cancer by measuring fluorescence exerted from the sample after the addition of a substance like SYBR Green dye. The main improvement in the included fluorimeter will be a small but more effective black covering which will serve as shielding during the time an image is taken. Unlike the box seen in the fluorimeter used in lab recently this covering will be more effective at shielding out light and at the same time be easier to handle and package due to its smaller size. Since it will be easier to package, it is conceivable that the entire diagnotic system could be available as six small packages with the fluorimeter pack being the second biggest after the PCR package. The improvement made on the fluorimeter's shielding addresses a major concern which was that occassionally more light than should have been present managed to pierce the droplet area during the time when a photograph was being taken, despite what should have been adequate shielding. Of course with this new system, this problem is much less likely to occur. ' Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]