BME100 f2013:W900 Group5 L6: Difference between revisions
Pedro Giorge (talk | contribs) |
Niko Vlastos (talk | contribs) |
||
Line 51: | Line 51: | ||
'''Background on the cancer-associated mutation'''<br> | '''Background on the cancer-associated mutation'''<br> | ||
"The human genome has 23 chromosomes. The 22nd chromosome contains a pathogenic single nucleotide polymorphism (SNP) known as Rs17879961. The Rs17879961nucleotide affects the checkpoint 2 (Chek2) gene. The (Chek2) gene mutation affects the cells’ tumor depressant." | |||
''[Instructions: Use the answers from questions 3, 4, 5, and 7 to compose, in your own words, a paragraph about rs17879961]'' | ''[Instructions: Use the answers from questions 3, 4, 5, and 7 to compose, in your own words, a paragraph about rs17879961]'' | ||
Revision as of 17:49, 25 November 2013
BME 100 Fall 2013 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR COMPANY
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD We used TinkerCAD to make improvements on the PCR test tubes. We made each test tube about 20% longer and labeled the caps of each tube. One row is red with the numbers zero through three and the other row is blue with the same numbers. We also a stamp that will hold the test tubes completely off the ground so that there is no wobbling when working with them. http://openwetware.org/images/4/4c/Tinkercad_pic_-1_for_BME_100.png
Using TinkerCAD to design and print out a specialized camera holder would make the design of the experiment optimal. By personalizing the camera holder, the camera being used will be fitted more efficiently, making the possibility of error (e.g. by bumping the camera and shifting it in open space on the general camera holder) less.
Feature 1: Cancer SNP-Specific Primers[Instructions: This information will come from the Week 9 exercises you did in lab. Your notes should be in a pdf file that is saved on Blackboard under your group.] Background on the cancer-associated mutation
Primer design
- GGAAGTGGGTCCTAAAAACTCTTACA
- TGCATACATAGAAGATCACAGTGGC How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.]
Feature 2: Consumables KitThe consumables that will be provided the box will go as follows:
The following issues will be addressed with the new and improved functionality of the box and it's content:
Feature 3: PCR Machine Hardware[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]
Feature 4: Fluorimeter Hardware[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.] |