BME100 f2013:W900 Group6 L6: Difference between revisions
Line 55: | Line 55: | ||
'''Primer design'''<br> | '''Primer design'''<br> | ||
* Forward Primer: | * Forward Primer: ACTCACTTAAACCATATTCT | ||
* Cancer-specific Reverse Primer: ''[Instructions: write the sequence of the forward primer]'' | * Cancer-specific Reverse Primer: ''[Instructions: write the sequence of the forward primer]'' | ||
Revision as of 11:26, 25 November 2013
BME 100 Fall 2013 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR COMPANY
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD On November 20th we worked with the Tinkercad tool in which we designed each of the past tools that we have used in our labs. We used the tinkercad tool to better the PCR Tubes, the Open PCR machine, the phone holder for the Fluorimeter and the packaging for these devices. First we worked on the PCR Tubes "Blacking them out" in order to prevent things from bleaching such as the SYBR green in the previous lab, we also added markings on the side in order to see the measurements in the tube. We also designed some of the packaging for the device as well as the PCR machine which was more of a software fix than an actual design flaw.
One possible way to use tinkerCAD for something practical is the camera holder. What tinkerCad allows us to do is design an object easily and is a free tool so we can design a project without the need to buy materials and supplies and prototype the design. When the model is completed tinkerCAD also allows us to print off the design with the use of a 3D printer. We came up with the design for the camera holder because the one used in the previous lab would not hold the phone in an upright position because it was not adjustable to the phone we used, we developed a new design for the holder by making it adjustable and easy to figure out and use.
Feature 1: Cancer SNP-Specific Primers[Instructions: This information will come from the Week 9 exercises you did in lab. Your notes should be in a pdf file that is saved on Blackboard under your group.] Background on the cancer-associated mutation
How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.]
Feature 2: Consumables Kit[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]
Feature 3: PCR Machine Hardware[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] It was noted that one of the weakness for the PCR machine was that it didn't have a way of logging/recorded data, during the time that the machine was running. Our team is going to address this problem by creating a communication connection between the data of the PCR machine to a computer. We will be doing this by adding a logging program and USB connection to the PCR machine that will automatically start and record all data being given off by the PCR machine. Feature 4: Fluorimeter Hardware[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic ApproachCalculation 3 is the positive predictive value: the probability that a cancerous patient will test positive with the PCR-based diagnostic test. The percent value for calculation 3 is a small value and has low specificity, telling us that there are a number of results that came back as false-positives. This informs us that some patients are non-cancerous but came back with a positive test result from the PCR-based diagnostic test. Calculation 4 is the negative predictive value: the probability that a non-cancerous patient will test negative with the PCR-based diagnostic test. The percent value for calculation 4 is close to one and has high sensitivity, suggesting that this test is a good standard. |