BME100 f2013:W900 Group6 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: James Mendoza Name: Courtney DuBois Name: Brandon Kehring Name: Areli Isherwood Name: Jacob Hulett GenX PCR-based Diagnostic Test LAB 6 WRITE-UP Computer-Aided Design TinkerCAD On November 20th, we worked with the TinkerCAD tool to design our improvements for the PCR-based Diagnostic Test. We used the TinkerCAD software to redesign the PCR Tubes, the Open PCR machine, the phone holder for the fluorimeter and the packaging for these devices. First, we worked on the PCR Tubes and made them blacked out in order to prevent the light from bleaching the SYBR green. We also added measurement markings on the sides of the PCR tubes in order to easily identify the volume of the solution in the tube. We also used the TinkerCAD tool to design the packaging for the device as well as the PCR machine (which was more of a software fix than an actual design flaw). Implications of Using TinkerCAD for Design One possible way to use the TinkerCAD tool for something practical is the camera holder aspect of the fluorimeter. TinkerCAD allows us to design an object easily and is a free application, so we can design a project without the need to buy materials and supplies for the prototype. When the model is complete, TinkerCAD allows users to print off the design via 3D printer. We changed the design of the camera holder because the one used in the previous lab would not hold the phone in an upright position as it did not directly fir the phone. We developed a new design for the phone holder by making it adjustable so that it is compatible with various models of phones. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Rs17879961 is a pathogenic single nucleotide polymorphism (SNP) that is found in Homo Sapiens. This single nucleotide polymorphism (SNP) is found in the 22nd chromosome of the 23 that Homo Sapiens contain. Rs17879961 affects the gene Checkpoint Kinase 2 (Chek2). This gene is a cell cycle checkpoint regulator that suppresses tumors and halts cell cycle progression when DNA is damaged. Primer design Forward Primer: ACTCACTTAAACCATATTCT Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC How the primers work: It beings with identifying the "target sequence," in this case the cancer-associated SNP rs17879961 . The primers specifically binds to the 3' end of the target sequence. Note that primers will only bind to the sequences that are complimentary to their own sequence. The primers then direct a DNA polymerase to synthesize the complementary DNA strands. Only DNA with the target sequence will be copied, because DNA polymerase can only copy the molecules with the primer attached; this is the reason why the non-cancer alleles will not be amplified. With each PCR cycle, partial target sequences and double stranded molecules, which contain only the target sequence, are “created” (also known as “amplified”). As the cycles continue, more target sequences of double stranded molecules (with the target sequence: rs17879961) and partial target sequences are produced. Consequently, with each PCR cycle, the number of strands with the target sequence grows exponentially (2^n). Essentially, after all cycles are complete, the end result will be a large number of pure target sequence molecules that only code for the SNP rs17879961 (the cancer-associated marker). Feature 2: Consumables Kit The GenX PCR-Based Diagnostic Test includes the PCR tubes, the PCR tube container (as well as holder), the newly designed camera/phone stand for the fluorimeter, as well as a micropipetor and the associated disposable tips. A major weakness we found with the PCR tubes was that the SYBR green solution was hypersensitive to light. This hypersensitivity caused skewed results due to the solution bleaching out in a short period of time. One way to address this problem is to make our PCR tubes black. In the original trial, the test tubes were clear, allowing light to penetrate the test tubes and bleach the SYBR green solution. If the test tubes are blacked out and block the outside light, then this could assist with slowing down the bleaching process of the SYBR green solution. Feature 3: PCR Machine Hardware The PCR Machine will be used in the same way as it was set up during the previous lab, the only difference will be the logging software used during the process. The PCR machine will duplicate the DNA strands in order to detect the cancer segment of the DNA, by denaturing the DNA with high temperatures, once the DNA is separated, the annealing process begins and primers are attached to the DNA segments, thus synthesizing complementary strands of DNA and held at a constant temperature to ensure the DNA is extended completely. It was noted that one of the weakness for the PCR machine was that it didn't have a way of logging recorded data during the time that the machine was running. Our team is going to address this problem by creating a communication connection between the data of the PCR machine to a computer. We will be doing this by adding a logging program and USB connection to the PCR machine that will automatically start and record all data being given off by the PCR machine. This recording of the data will help users determine if the PCR machine is properly functioning before testing various solutions for the cancer allele. Feature 4: Fluorimeter Hardware Our lab group determined that the fluorimeter completed its job efficiently. We did, however, alter the design to the phone stand used within the fluorimeter. We designed a new stand that allows various models of phones to be used in the fluorimeter in the upright position. One design flaw with the fluorimeter was the stand used to hold the phone. The stand was not very stable with the model of phone our lab group used in the lab. This unstable base allowed the phone to move between trials causing variations in the pictures taken for analysis. If the stand was redesigned in a way that would make it universal to all phones, then it would be much more user-friendly. This would be an easy fix that would greatly improve the functionality of this device with all models of phones. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach Calculation 3 is the positive predictive value: the probability that a cancerous patient will test positive with the PCR-based diagnostic test. The percent value for calculation 3 is a small value and has low specificity, telling us that there are a number of results that came back as false-positives. This informs us that some patients are non-cancerous but came back with a positive test result from the PCR-based diagnostic test. Calculation 4 is the negative predictive value: the probability that a non-cancerous patient will test negative with the PCR-based diagnostic test. The percent value for calculation 4 is close to one and has high sensitivity, suggesting that this test is a good standard. Instruction Manual The Open PCR machine that takes a specific strand of DNA and amplifies it by making millions of copies of that segment of DNA. The way it does this is it goes through several heating and cooling cycles, allowing the DNA to split at high temperatures about 95 degrees Celcius which the temperature, amount of cycles and these can be set and changed through the software on a computer that is connected to the Open PCR machine through a USB cable. An enzyme is added before the process that allows for a complementary strand of DNA to be paired when the temperature is at a lower temperature in the case of our lab it was 4 degrees Celsius and the process is repeated. For the fluorimeter we first have to place the fluorimeter under all of the components needed to reduce outside contamination and this includes the cover which we used a box to "blackout" the area in order to obtain the best picture possible to determine the status of the patient whether they have cancer or not.