BME100 f2013:W900 Group7 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Abby Monhollen Name: Roberto A. Aguirre Name: student Name: student Name: student Name: student [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD On November 20th Tinkercad was used to redesign the PCR tubes. A twistable top was added so that the seal would be tighter and a labeling section was added where the tube can be labeled, therefore preventing any confusion. The number of PCR tubes was doubled so that more things could be mixed. Implications of Using TinkerCAD for Design [Instructions: A short paragraph discussing just one possible way to use TinkerCAD for something practical...like redesigning the OpenPCR machine, fluorimeter, camera holder, printing out some of the smaller plastic items on demand, etc. There are lots of possibilities...pick just ONE.] Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Nucleotides are the building blocks of all DNA strands and RNA strands. Nucleotides are made up of a nitrogen base, a sugar, and a phosphate group, and the sequence of nucleotides determines the different proteins that are produced in translation. The four nucleotide bases that determine this sequence in DNA are adenine (A), thymine (T), guanine (G), and cytosine (C). A polymorphism occurs when different phenotypes exist in the same population of a species, so a single nucleotide polymorphism is when a single nucleotide differs between individuals in the same population. These SNPs can result in different diseases, such as cancer. In this test, the gene under investigation is rs17879961. This single nucleotide polymorphism is found in Homo sapiens (humans) and is located on the 22 pair of chromosomes (humans have 23 pairs of chromosomes). The clinical significance of this SNP is pathogenic, which means that is is capable of causing disease. The gene affected by this SNP is called CHEK2, which stands for checkpoint kinase 2. This gene encodes for a protein that is used at the second checkpoint of the cell cycle--when the protein is activated it prevents damaged cells from entering mitosis and proceeding through the cell cycle. However with this polymorphism, the protein could be damaged and therefore fail to stop damaged cells from entering and reentering the cell cycle uncontrollably, which causes cancer. . Primer design Forward Primer: ACTCACTTAAACCATATTCT Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACA How the primers work: The primers work by attaching to very specific segments of DNA. The primers can only bind to a sequence with complementary DNA. If a region does not contain complementary DNA, the primer will not be attached and transcription will not occur. Therefore primers are cancer-sequence specific because they will only bind to regions containing the cancer gene. After binding to the specific region, transcription occurs and the gene of interest is copied. This process continues as primers continue to only bind to the sequences of DNA containing the cancer causing gene, resulting in many copies of the cancer gene. If the cancer gene is not contained in a sequence, the primer will not attach to the region and transcription will not occur. Therefore, transcription will not occur for segments of DNA that do not contain a particular sequence and gene of interest and amplification of the sequence will not occur. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware [Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] [Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]