BME100 f2013:W900 Group7 L6

BME 100 Fall 2013	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR COMPANY Name: Abby Monhollen Name: Roberto A. Aguirre Name: student Name: student Name: student Name: student [Instructions: add the name of your team's company and/or product here] LAB 6 WRITE-UP Computer-Aided Design TinkerCAD On November 20th, Tinkercad was used to redesign the PCR tubes. A twistable top was added so that the seal would be tighter and a labeling section was added where the tube can be labeled, thereby preventing any confusion. The number of PCR tubes was doubled so that more reagents and solutions could be mixed. Implications of Using TinkerCAD for Design There are many ways to use Tinkercad to improve a product. It can be used to improve a PCR machine by printing out different designs for it so that biomedical engineers would be able to test and evaluate different designs to see which one is best before making the final product. Once 3D printing improves, it could be used to design and print out a PCR machine with different materials. That is how Tinkercad could be used to improve a PCR machine. Feature 1: Cancer SNP-Specific Primers Background on the cancer-associated mutation Nucleotides are the building blocks of all DNA strands and RNA strands. Nucleotides are made up of a nitrogen base, a sugar, and a phosphate group, and the sequence of nucleotides determines the different proteins that are produced in translation. The four nucleotide bases that determine this sequence in DNA are adenine (A), thymine (T), guanine (G), and cytosine (C). A polymorphism occurs when different phenotypes exist in the same population of a species, so a single nucleotide polymorphism is when a single nucleotide differs between individuals in the same population. These SNPs can result in different diseases, such as cancer. In this test, the gene under investigation is rs17879961. This single nucleotide polymorphism is found in Homo sapiens (humans) and is located on the 22 pair of chromosomes (humans have 23 pairs of chromosomes). The clinical significance of this SNP is pathogenic, which means that is is capable of causing disease. The gene affected by this SNP is called CHEK2, which stands for checkpoint kinase 2. This gene encodes for a protein that is used at the second checkpoint of the cell cycle--when the protein is activated it prevents damaged cells from entering mitosis and proceeding through the cell cycle. However with this polymorphism, the protein could be damaged and therefore fail to stop damaged cells from entering and reentering the cell cycle uncontrollably, which causes cancer. . Primer design Forward Primer: ACTCACTTAAACCATATTCT Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACA How the primers work: The primers work by attaching to very specific segments of DNA. The primers can only bind to a sequence with complementary DNA. If a region does not contain complementary DNA, the primer will not be attached and transcription will not occur. Therefore primers are cancer-sequence specific because they will only bind to regions containing the cancer gene. After binding to the specific region, transcription occurs and the gene of interest is copied. This process continues as primers continue to only bind to the sequences of DNA containing the cancer causing gene, resulting in many copies of the cancer gene. If the cancer gene is not contained in a sequence, the primer will not attach to the region and transcription will not occur. Therefore, transcription will not occur for segments of DNA that do not contain a particular sequence and gene of interest and amplification of the sequence will not occur. Feature 2: Consumables Kit [Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.] [Instructions: IF your consumables packaging plan addresses any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Feature 3: PCR Machine Hardware The PCR machine within our product will function the same as the PCR machines used in previous labs. The PCR machine will come pre-assembled so that there is no user-error while trying to assemble the machine. The machine will be packaged safely and securely to prevent any damage to the machine. Also, an instruction sheet and software CD will be included with the machine. The instruction sheet will provide the user with easy to understand instructions on how to run the PCR test and the settings for the tests. Feature 4: Fluorimeter Hardware [Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.] [Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.] Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach In the Bayesian statistics Calculation 3 shows the sensitivity of the patients' results, this describes the patients' probability of testing positive for the cancer disease. After doing all of the calculations the result for Calculation 3 was very small, showing that the PCR tests typically gave a false positive for the cancer disease. This means that the PCR machine was not reliable in matching a positive PCR result to a positive biopsy result. For Calculation 4 the specificity of the patients' results are found. Specificity is the patients' probability of testing negative for the cancer disease. The result we got was barely less than one, this means that the PCR testing was highly efficient in finding a negative result for the patients that correlated to a negative biopsy result. Due to the fact that the PCR machine gave out false positives so often the CHEK2 PCR system was not reliable, though it did often give the right negative test results.