BME100 f2016:Group14 W1030AM L4

BME 100 Fall 2016	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
THE BME TEAM Name: Kyle Aubel Name: Tina Kaing Name: Kevin Shultz Name: Jose Galaviz Garcia Name: Norberto Rodriguez Marquez LAB 4 WRITE-UP Protocol Materials Lab coat and disposable gloves PCR reaction mix, 8 tubes, 50 µL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP's (http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless-master-mix-m714-protocol/) DNA/primer mix, 8 tubes 50 µL each Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer A strip of empty PCR tubes Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated Cup for discarded tips Micropipettor OpenPCR machine: shared by two groups PCR Reaction Sample List Tube Label PCR Reaction Sample Patient ID G14 + Positive control None G14 - Negative control None G14 1-1 Patient 1, replicate 1 15727 G14 1-2 Patient 1, replicate 2 15727 G14 1-3 Patient 1, replicate 3 15727 G14 2-1 Patient 2, replicate 1 52298 G14 2-2 Patient 2, replicate 2 52298 G14 2-3 Patient 2, replicate 3 52298 DNA Sample Set-up Procedure Move Extracted DNA to PCR reaction mix Add DNA/ primer mix to PCR tube Add Nucleotides to PCR tube Add DNA Polymerase to the PCR tube Place PCR tube into Thermal Cycler OpenPCR program Heated Lid: 100°C Initial Step: 95°C for 2 minutes Number of Cycles: 25 Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 Seconds Final Step: 72°C for 2 minutes Final Hold: 4°C The initial heating to 95°C denatures or unzips the DNA double helix, it is then cooled to 57°C and this is when Primer 1 and Primer 2 can attach to the beginning and end parts of the targeted unzipped DNA strands. At 57°C the single strands of DNA try to reattach but the Primers attach before the strands are able to. The Thermal Cycler is then heated to 72°C which activates DNA polymerase and it duplicates the targeted strand of DNA between the two primers. This Process is repeated for 25 cycles of Heating to denature DNA helix, cooling to attach primers, Heating to activate DNA polymerase and then obtaining the newly targeted DNA strand. Research and Development PCR - The Underlying Technology Q1. What is the function of each component of a PCR reaction? In order to conduct a PCR reaction, there are four necessary components which includes the template DNA strand, primers, Taq polymerase, and deoxyribonucleotides (dNTPs). The function of the template DNA is to serve as the DNA which provides the original strand that will undergo DNA replication to synthesize a complimentary strand of DNA. In a PCR reaction, the template DNA, having a particular target sequence, will then be placed into thermal cycling to prepare for the presence of primers. Primers are short pieces of DNA made within a laboratory that have the ability to bind to either end of a target sequence. In the case of a PCR reaction, the function of primers is to bind to the designated end of the target sequence that is being replaced. Following this, Taq polymerase is introduced into the reaction and functions as a protein that attaches to the complimentary primers and allows for the formation of a second strand of DNA while using the other strand as a base or template for replication. The final component of a PCR reaction known as deoxyribonucleotides, are fragments of DNA which provides the code necessary for taq polymerase to replicate the targeted sequence. Q2. What happens to the components (listed above) during each step of thermal cycling? The first step within thermal cycling is to heat the thermal cycler up to 95°C and maintain this temperature for three minutes. During this time, the template DNA is heated and undergoing preparation for the next step. Following heating, denaturation of the template DNA occurs at 95°C for 30 seconds. Due to the high temperature, the hydrogen bonds present between the double helix structure of DNA is broken into two separate strands resulting in two single strands that will serve as the templates for the formation of new strands. The temperature is then lowered to 57°C for 30 seconds, where annealing occurs. At this temperature, primers are able to attach to specific locations on the single stranded DNA. Following this, the temperature is then raised to 72°C for 30 seconds to allow for extending to occur. During this time, the increase in temperature allows for new DNA to be synthesized by the means of Taq polymerase. Taq polymerase functions by locating a primer attached to a single DNA strand and adding complementary nucleotides onto the strand. This process continues to occur until it reaches the end of the strand. The components of the mixture are then held at 72°C for another 3 minutes to stimulate Taq polymerase to fully copy, ensuring no missed primers. Finally, the temperature is lowered to 4°C to prevent further replication of DNA and allow for proper storage. Q3. DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed below? Given the nucleotides A (Adenine), T (Thymine), C (Cytosine), and G (Guanine) each particular base anneals to a specific base. In the case of Adenine, it anneals with Thymine. Likewise, Thymine anneals with Adenine. Similarly, Cytosine anneals to Guanine and likewise, Guanine anneals to Cytosine. Q4. During which two steps of thermal cycling does base-pairing occur? Explain your answers. Base pairing occurs during the annealing of the mixture at 57°C and the extension of the mixture at 72°C. During annealing, the lowered temperature of 57°C allows for primers to attach to specific locations on the single stranded DNA. In order for the attachment to occur, the process of base-pairing must occur as the primers serve as the complimentary sequence to that of the single stranded DNA. During the step which involves the extension of the mixture at 72°C, base-pairing also occurs through the presence of the Taq polymerase. As Taq polymerase functions by attaching to the primer and adding DNA bases, through base-pairing, there is the formation of the complimentary strand. SNP Information & Primer Design Background: About the Disease SNP The disease SNP (single nucleotide polymorphism) can be described as a disease-associated DNA sequence. This is due to the changing of a single nucleotide, which is the basic structural unit of nucleic acids. Polymorphism then takes form from the presence of variation, where natural selection can operate within a population. SNP can affect a gene's function, and can thus provide damaging effects to people. "They can also act biological markers, helping scientists locate genes that are associated with disease" (What are SNPS). SNP is a normal process that occurs in peopes' DNA, with about 10 million SNP's in the human genome. The effect of SNP is usually harmless to people, but must be studied to know the absolute effect. Citation: What are single nucleotide polymorphisms(snps)? (2016). U.S. National Library of Medicine. Retrieved from NIH website https://ghr.nlm.nih.gov/primer/genomicresearch/snp. Primer Design and Testing In this part we defined the genotype ANK2 which stand for Ankyrin 2 and its function. the functions of this genotype are the following: ATPase binding, cytoskeleton adapter activity and enzyme binding. Also we had to do define the vocabulary allele which means that is a different form of a gene that causes the mutation which are found along the same chromos. we also identified the codon that activate the disease which is ATC. Meaning this codon is the one that causes the disease. While the codon CTC is the healthy allele. The position of this gene was 113367751. After we obtain the position of the SNP, we were able to design a non-disease forward primer which contains 20 bases long finishing at the posing of the SNP. The following is the non-disease forward primer we obtain GGACAGCTCAGCAACAGCAC. Once we had the forward primer we design a non-disease reverse primer by adding a total of 200 bases to the original position number. this resulted to the following position 113367951 and the following non disease reverse primer ​TAAAAAGTATTTAAAAACTA. After we had design a non-disease forward and reverse primers we had to design two diseases forward and reverse primers. We obtain this primer by changing the last codon of the non-disease forward primer from a C to an A that mutation converts the non-diseases forward primer to a disease forward primer. the disease forward primer was GGACAGCTCAGCAACAGCAA and the disease reverse primer was TAAAAAGTATTTAAAAACTA. After we validated the primers and the result we obtained was the predicted. Disease-Specific Forward and Reverse Primers: Non-disease Forward and Reverse Primers: Image References: Kent, J. (2009) USCS In-Silico PCR. USCS Genome Bioinformatics. Retrieved from [1]