BME100 s2017:Group1 W8AM L4: Difference between revisions
(4 intermediate revisions by 2 users not shown) | |||
Line 91: | Line 91: | ||
<!-- Add a write-up, essay-style, organized into paragraphs with descriptive headers, based on the questions and answers from the Research and Development exercise. BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the PCR video/ tutorial might be useful. Be sure to '''credit the sources''' if you borrow images. You are not allowed to use images from current or past BME 100 students' reports on OpenWetWare. --> | <!-- Add a write-up, essay-style, organized into paragraphs with descriptive headers, based on the questions and answers from the Research and Development exercise. BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the PCR video/ tutorial might be useful. Be sure to '''credit the sources''' if you borrow images. You are not allowed to use images from current or past BME 100 students' reports on OpenWetWare. --> | ||
What is the function of each component of a PCR reaction? | |||
{| {{table}} | {| {{table}} | ||
|- | |- | ||
Line 104: | Line 104: | ||
What happens to the components (listed above) during each step of thermal cycling? <br> | |||
Initial step (95°C for 3 minutes): It makes DNA double helix separates and activate the hot start polymerase. <br> | |||
Denature | Denature (95°C for 30 seconds): The template DNA double helix separates,creating two single-stranded DNA molecules. <br> | ||
Anneal | Anneal (57°C for 30 seconds): Primers pair lock onto their target. <br> | ||
Extend | Extend (72°C for 30 seconds): DNA polymerase is activated, and will match complementary nucleotides onto the strand. <br> | ||
Final step (72°C for 3 minutes): All products promote to complete synthesis. <br> | |||
Final hold (4°C): DNA molecules are preserved. <br> | |||
DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed below? <br> | |||
Adenine(A): Thymine(T) <br> | Adenine (A): Thymine (T) <br> | ||
Thymine(T): Adenine(A) <br> | Thymine (T): Adenine (A) <br> | ||
Cytosine(C): Guanine(G) <br> | Cytosine (C): Guanine (G) <br> | ||
Guanine(G): Cytosine(C) <br> | Guanine (G): Cytosine (C) <br> | ||
During which two steps of thermal cycling does base-pairing occur? <br> | |||
Annealing and Extending are the two steps of the thermal cycling in which the base-pairing occurs. In the annealing step, when the temperature drops, the DNA is separated in two strand which allows the primers to attach to it. After, in the extending step, the temperature goes up to 72 degrees which allows the DNA polymerase to pair the correct bases to the DNA strand. | Annealing and Extending are the two steps of the thermal cycling in which the base-pairing occurs. In the annealing step, when the temperature drops, the DNA is separated in two strand which allows the primers to attach to it. After, in the extending step, the temperature goes up to 72 degrees which allows the DNA polymerase to pair the correct bases to the DNA strand. | ||
<br><br> | <br><br> | ||
Line 126: | Line 126: | ||
==SNP Information & Primer Design== | ==SNP Information & Primer Design== | ||
'''Background: About the Disease SNP''' | '''Background: About the Disease SNP''' <br> | ||
<!-- INSTRUCTIONS: This content is from PCR Lab B. Write a summary, at least five sentences long, about the disease SNP in your own words. --> | <!-- INSTRUCTIONS: This content is from PCR Lab B. Write a summary, at least five sentences long, about the disease SNP in your own words. --> | ||
An SNP is a variation of a phenotype found in homo sapiens. SNPs are located in the chromosome 7:117587799. Cardiac failure, as well as cystic fibrosis can be linked to SNPs. The affected allele contains the codon CGT. A non-diseased forward primer is as follows | An SNP is a variation of a phenotype found in homo sapiens. SNPs are located in the chromosome 7:117587799. Cardiac failure, as well as cystic fibrosis can be linked to SNPs. The affected allele contains the codon CGT. A non-diseased forward primer is as follows | ||
Line 132: | Line 132: | ||
The disease forward primer changes the last letter of that primer, resulting in | The disease forward primer changes the last letter of that primer, resulting in | ||
*5’ CATTATTTATAGTTCTTAAA 3’. | *5’ CATTATTTATAGTTCTTAAA 3’. | ||
'''Primer Design and Testing''' | '''Primer Design and Testing'''<br> | ||
<!-- INSTRUCTIONS: Write a short summary of the results of your primer test. Underneath your summary, include a screen capture of the results web page. You may crop the image so that it only includes the relevant information. --> | <!-- INSTRUCTIONS: Write a short summary of the results of your primer test. Underneath your summary, include a screen capture of the results web page. You may crop the image so that it only includes the relevant information. --> | ||
The primer test was performed by finding the nucleotide containing the CTFR variation of the primer, modifying it, and entering into the database containing other primers. The non-diseased primer had a match, since it is in the database. There was no match for the diseased primer. | |||
[[Image: BMEPROJECT.jpg|1000px|thumb|]] | |||
[[Image: BMEPROJECT.jpg| | |||
Latest revision as of 22:37, 21 March 2017
BME 100 Spring 2017 | Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||
THAT BME GROUPLAB 4 WRITE-UPProtocolMaterials
DNA Sample Set-up Procedure
Research and DevelopmentPCR - The Underlying Technology What is the function of each component of a PCR reaction?
SNP Information & Primer DesignBackground: About the Disease SNP
The disease forward primer changes the last letter of that primer, resulting in
Primer Design and Testing
|