BME103:T130 Group 11 l2: Difference between revisions
Line 181: | Line 181: | ||
The fluorimeter was switched on, and the smartphone was placed in the smartphone stand at a good angle to take photos of the results. The fluorimeter was switched on, and a glass slide was put into place so that the light shone through the middle of the first two rows on the slide. A pipette was used to place two large drops of the SYBR GREEN I solution onto the first two centered holes on the slide. Then, using the correct pipette, two dropes of the first DNA sample, sample 1a, was added to the droplet that had formed from the two drops of SYBR GREEN I. The light was aligned again to make sure that it was going through the center of the drop. The box was arranged to put the fluorimeter into darkness and the smartphone was used to take pictures of the droplet. Once enough pictures were taken, a pipette set aside especially for waste was used to remove the droplet and dispose of it in a cup set aside for waste. The glass slide was then moved forward so that the light shone through the center of the next two rows of holes. The process was repeated for each DNA sample and for the controls, as well as for the calf thymus DNA and the water in the scintillation vial. Each time, the corresponding pipettes for each tube was used, and kept separate from other pipettes so as to prevent contamination. Besides that, a new glass slide was used after 5 droplets were placed on the previous glass slide, and the used and contaminated glass slides were disposed of correctly. | The fluorimeter was switched on, and the smartphone was placed in the smartphone stand at a good angle to take photos of the results. The fluorimeter was switched on, and a glass slide was put into place so that the light shone through the middle of the first two rows on the slide. A pipette was used to place two large drops of the SYBR GREEN I solution onto the first two centered holes on the slide. Then, using the correct pipette, two dropes of the first DNA sample, sample 1a, was added to the droplet that had formed from the two drops of SYBR GREEN I. The light was aligned again to make sure that it was going through the center of the drop. The box was arranged to put the fluorimeter into darkness and the smartphone was used to take pictures of the droplet. Once enough pictures were taken, a pipette set aside especially for waste was used to remove the droplet and dispose of it in a cup set aside for waste. The glass slide was then moved forward so that the light shone through the center of the next two rows of holes. The process was repeated for each DNA sample and for the controls, as well as for the calf thymus DNA and the water in the scintillation vial. Each time, the corresponding pipettes for each tube was used, and kept separate from other pipettes so as to prevent contamination. Besides that, a new glass slide was used after 5 droplets were placed on the previous glass slide, and the used and contaminated glass slides were disposed of correctly. | ||
After all the images of the droplets containing the samples are taken, the ImageJ Software is utilized to measure the amount of the desired gene sequence in each droplet. For each drop, we split the color channels so that we can analyze only the green part of the image. The droplet is selected in the green part of the image, and then the green pixels are measured, called the Integrated Density. Using the same area of the droplet, we take a measurement from the dark background. Subtracting the density of the background from the droplet, we arrive at the Integrated Density that is used to determine the DNA density. DNA μg/mL is calculated by multiplying the Integrated density of the sample, with the background subtracted, by two and then dividing by the calf thymus integrated density. | |||
==Research and Development== | ==Research and Development== |
Revision as of 13:20, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
In order to increase tube space, we increase the heating plate and increase the power proportionally to the size of the plate. We would also add more ventilation next to the heating plate in order to speed up the cooling process of the DNA. Key Features
Stage one: 1 cycle, 95 Degrees C for 3 minutes Stage two: 35 cycles, 95 Degrees C for 30 seconds, 57 Degrees C for 30 seconds, 72 Degrees C for 30 seconds Stage three: 72 Degrees C for 3 minutes Final hold: 4 Degrees C For the PCR reaction mix, up to 96 tubes (50 uL each). The mix contains Taq DNA polymerase, MgCl2, dNTP's, forward primer, and reverse primer. Use transfer pipetts (only use each pipette once) to transfer the samples. After placing the samples in the tube space and securing the lid, begin the PCR Machine and wait until completion.
ProtocolsMaterials
PCR Protocol
Research and DevelopmentCystic Fibrosis is a genetically inherited disease that is derived from the production of excessive mucous build up in the respiratory tract. This has a major effect on the body's endocrine system, more specifically in the digestive and respiratory systems.
More information on the gene can be found at http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35731153
The forward primer for this disease would be CAGTCGCAGACGGAGAGGCAT while the reverse primer for without the disease would be GTCAGCGTCTCCCTCTCCGTA. If the patient was positive for the cystic fibrosis mutation, the reverse primer would be GTCAGCGTCTGCCTCTCCGTA. The difference between the mutation and the normal strand is that the normal strand has the allele TCC where the mutation has TGC. So the C and the G is changed. When the primer is made and put into the PCR machine, it will only attach to the mutation strands. If the primer matches up, it will glow under a black light therefore indicating that the patient has the disease. If there is no glow, that means the patient does not have that type of cystic fibrosis.
Web Link - http://www.britannica.com.ezproxy1.lib.asu.edu/EBchecked/topic/148824/cystic-fibrosis-CF/
Illustration
|