Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
The old design of the PCR Machine is as follows, including only 16 tube slots:
The goal of our PCR redesign is to add more test tube space, making the PCR more efficient:
In order to increase tube space, we increase the heating plate and increase the power proportionally to the size of the plate. We would also add more ventilation next to the heating plate in order to speed up the cooling process of the DNA.
Key Features
Critical features to our design include an increase in tube space from 16 tube slots to 96. In doing this, the area of the heating plate is increased relative to the space the tubes take up. The increased area of the heating plate will require added ventilation to speed up the cooling process. The increased heating plate is necessary, because the PCR requires a series of heating up and cooling down the DNA to specific temperatures so that the DNA will multiply.
The benefits of increasing the tube space would be that the PCR would be more efficient. It would be more efficient because the Machine would be able to test more subjects at the same rate, allowing for increased amount of trials and increased amount of patients. This product would be more effective in a lab or clinic that performs mass testing for diseases.
Instructions
Obtain the DNA samples in the 50 uL tubes each.
Create a program on the machine as follows:
Stage one: 1 cycle, 95 Degrees C for 3 minutes
Stage two: 35 cycles, 95 Degrees C for 30 seconds, 57 Degrees C for 30 seconds, 72 Degrees C for 30 seconds
Stage three: 72 Degrees C for 3 minutes
Final hold: 4 Degrees C
For the PCR reaction mix, up to 96 tubes (50 uL each). The mix contains Taq DNA polymerase, MgCl2, dNTP's, forward primer, and reverse primer.
Use transfer pipetts (only use each pipette once) to transfer the samples.
After placing the samples in the tube space and securing the lid, begin the PCR Machine and wait until completion.
Protocols
Materials
Supplied in the Kit
Amount
SYBR Green I
800 μL
Calf Thymus DNA
800 μL
PCR tubes
95 tubes
Negative control
1
Positive control
1
Pipettes
100 pipettes
Microtubes
93 tubes
Negative control
100 μL
Positive control
100 μL
Fluorimeter
1
Smartphone stand
1
CD with ImageJ and OpenPCR software
1
Primer 1
20 ml
Primer 2
20 ml
Glass slides
20
Buffer
40 ml
Eppendorf tubes
95 tubes
Box for fluorimeter
1
Supplied by User
Amount
DNA samples
93 samples
Smartphone for fluorimeter
1
External computer
1
Heatproof marker pen
1
Cup for waste
1
PCR Protocol
First, DNA samples were obtained from 31 different patients, each were given 3 DNA samples. These DNA samples were stored in a freezer in microtubes. For patient number 1, his or her DNA samples were labelled 1a, 1b and 1c, using the heatproof marker. The other DNA samples from the remaining 30 patients were labelled in the same way. After all the DNA samples were obtained, each sample was transferred over to PCR tubes, which are tubes that are used especially for the PCR process. Each PCR tube was labelled in the same way as before. In addition to these 93 PCR tubes, two more tubes, each containing a negative control and a positive control respectively. The PCR tube containing the negative control was labelled "-" and the PCR tube containing the positive control was labelled "+". Using separate pipettes for each DNA sample and the controls, Primer 1 was added to every PCR tube. Once Primer 1 was added, Primer 2 was added to all the tubes as well, with separate pipettes still being used for all transfers. After these two primers are added, nucleotides are added in the same way. Finally, DNA Polymerase is added to all the PCR tubes.
All 95 of the PCR tubes are placed into the PCR machine, and the software for the PCR machine was opened on the computer that the PCR machine was connected to, and the PCR machine was automated for the necessary amount of heating and cooling cycles so as to produce a clear result.
DNA Measurement Protocol
The fluorimeter was set up according to the image shown below.
After the heating and cooling cycles were done, all of the PCR tubes were taken out of the PCR machine. 95 Eppendorf tubes were filled with 400μL of buffer. Using separate pipettes for each tube (all of which were labelled according to the corresponding tube), all of the samples as well as the controls were transferred into these Eppendorf tubes. Each Eppendorf tube was labelled by the sample, as was earlier done for the PCR tubes, using the marker. Another Eppendorf tube was filled with the calf thymus DNA (standard at 2 micrograms/ml), and this tube was marked with a red dot on the top of the tube, using a marker. A scintillation vial was filled with deionized water, and another Eppendorf tube was almost completely filled with the SYBR Green I solution. The Eppendorf tube containing the SYBR Green I was marked on the top with a blue dot.
The fluorimeter was switched on, and the smartphone was placed in the smartphone stand at a good angle to take photos of the results. The fluorimeter was switched on, and a glass slide was put into place so that the light shone through the middle of the first two rows on the slide. A pipette was used to place two large drops of the SYBR GREEN I solution onto the first two centered holes on the slide. Then, using the correct pipette, two dropes of the first DNA sample, sample 1a, was added to the droplet that had formed from the two drops of SYBR GREEN I. The light was aligned again to make sure that it was going through the center of the drop. The box was arranged to put the fluorimeter into darkness and the smartphone was used to take pictures of the droplet. Once enough pictures were taken, a pipette set aside especially for waste was used to remove the droplet and dispose of it in a cup set aside for waste. The glass slide was then moved forward so that the light shone through the center of the next two rows of holes. The process was repeated for each DNA sample and for the controls, as well as for the calf thymus DNA and the water in the scintillation vial. Each time, the corresponding pipettes for each tube was used, and kept separate from other pipettes so as to prevent contamination. Besides that, a new glass slide was used after 5 droplets were placed on the previous glass slide, and the used and contaminated glass slides were disposed of correctly.
After all the images of the droplets containing the samples are taken, the ImageJ Software is utilized to measure the amount of the desired gene sequence in each droplet. For each drop, we split the color channels so that we can analyze only the green part of the image. The droplet is selected in the green part of the image, and then the green pixels are measured, called the Integrated Density. Using the same area of the droplet, we take a measurement from the dark background. Subtracting the density of the background from the droplet, we arrive at the Integrated Density that is used to determine the DNA density. DNA μg/mL is calculated by multiplying the Integrated density of the sample, with the background subtracted, by two and then dividing by the calf thymus integrated density.
Research and Development
Cystic Fibrosis is a genetically inherited disease that is derived from the production of excessive mucous build up in the respiratory tract. This has a major effect on the body's endocrine system, more specifically in the digestive and respiratory systems.
Background on Disease Markers
The marker SNP for the disease of cystic fibrosis that is being used is rs35731153. This disease can be found on chromosome 16. Cystic fibrosis gene is a mutation in the gene for the protein cystic fibrosis transmembrane conductance regulator. The cystic fibrosis gene mainly affects the lungs but also the pancreas, liver, and intestines. It is a scarring and cyst formation in the pancreas and causes trouble breathing. This often leads to lung infections. Ultimately death occurs unless a lung transplant can be completed.
The forward primer for this disease would be CAGTCGCAGACGGAGAGGCAT while the reverse primer for without the disease would be GTCAGCGTCTCCCTCTCCGTA. If the patient was positive for the cystic fibrosis mutation, the reverse primer would be GTCAGCGTCTGCCTCTCCGTA. The difference between the mutation and the normal strand is that the normal strand has the allele TCC where the mutation has TGC. So the C and the G is changed. When the primer is made and put into the PCR machine, it will only attach to the mutation strands. If the primer matches up, it will glow under a black light therefore indicating that the patient has the disease. If there is no glow, that means the patient does not have that type of cystic fibrosis.
BME 103 Fall 2012
