BME103:T130 Group 12

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Justin Landstrom Experimental Protocol Planner Name: Chiao May Lee Experimental Protocol Planner Name: James Kyeh Machine Engineer(s) Name: student Role(s) Name: student Role(s) Name: student Role(s) LAB 1 WRITE-UP Initial Machine Testing The Original Design () Experimenting With the Connections When we unplugged (part 3) from (part 6), the machine ... (did what? fill in your answer) When we unplugged the white wire that connects (part 6) to (part 2), the machine ... (did what? fill in your answer) Test Run (Write the date you first tested Open PCR and your experience(s) with the machine) Protocols Polymerase Chain Reaction A polymerase chain reaction (PCR) is based on the enzyme DNA Polymerase's ability to synthesize complementary DNA strands. Through a series of steps involving polymerase breaking apart a DNA strand and then synthesizing a specified complementary piece, a PCR machine is able to isolate and amplify a desired strand of DNA. Steps to Amplify a Patient's DNA Sample 1. This is step 1 2. This is where step 2 will go 3. Здравствуйте! 4. And step 4 is not in Russian Components of PCR Master Mix Reagent Volume Template DNA (20 ng) 0.2μL 10μM forward primer 1.0μL 10μM reverse primer 1.0μL GoTaq master mix 50.0μL dH2O 47.8μL Total Volume 100μL Flourimeter Measurements (Add your work from Week 3, Part 2 here) Research and Development Specific Cancer Marker Detection - The Underlying Technology The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.) Results (Your group will add the results of your Fluorimeter measurements from Week 4 here)