BME103:T130 Group 15 l2: Difference between revisions
Nehal Jolly (talk | contribs) |
Ben Reising (talk | contribs) |
||
(20 intermediate revisions by 4 users not shown) | |||
Line 14: | Line 14: | ||
|- | |- | ||
| [[Image:LilyHIMYM.jpg|100px|thumb|Alyssa Alexander<br> Research & Development]] | | [[Image:LilyHIMYM.jpg|100px|thumb|Alyssa Alexander<br> Research & Development]] | ||
| [[Image: | | [[Image:34619322.jpg|100px|thumb|Name: Nehal Jolly<br>Research and Development]] | ||
| [[Image:Dolphin.gif|100px|thumb|Sichun Ai<br>protocols planner]] | | [[Image:Dolphin.gif|100px|thumb|Sichun Ai<br>protocols planner]] | ||
| [[Image:IMG 0929.jpg|100px|thumb|Malik Alnaim<br>protocols planner]] | | [[Image:IMG 0929.jpg|100px|thumb|Malik Alnaim<br>protocols planner]] | ||
| [[Image: | | [[Image:Zack De La Rocha.jpg|100px|thumb|Name: Ben Reising<br>Thermal Cycler Engineer]] | ||
| [[Image:Georgebush.jpg|100px|thumb|Mayuri Gupta <br> Thermal Cycler Engineer]] | |||
|} | |} | ||
Line 30: | Line 31: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:PCR Side Air (2).jpg|400px]] | |||
[[Image:PCR_Front_Air_(2).jpg|400px]] | |||
'''Key Features'''<br> | '''Key Features'''<br> | ||
As one can see in these two images, the picture features the PCR machine, stripped of everything internal except for the exhaust fan. Our idea of improving this machine is to add an additional fan, to deal with the buildup of heat. The PCR machine is designed to heat up the samples, increasing internal temperature due to the trapped heat. While the exhaust fan does assist in keeping a reasonable temperature, the hot air it removes is only directly being pushed out, there is no active air flow through the machine, which would cool it better, only an active air flow out of the machine. | |||
While only pushing air out works, adding an extra fan opposite of the exhaust fan would create air flow through the entire machine, pulling in room temperature air, allowing better circulation. If the fan were added on, there is no reason that the machine could not keep a constant temperature only a couple degrees above room temperature. | |||
'''Instructions'''<br> | '''Instructions'''<br> | ||
The overall instructions in the usage of the PCR machine will not drastically change as the individual who is using it will not have to change the manner in which they handle the machine. However; as the cooling of the allows for the samples to run at an increased pace. The exhaust fan increases the active air flow thus eliminating the time needed for cooling and reheating; in the original machine this was a large factor in the amount of time PCR took overall. Therefore the individual simply needs to input the samples in the machine as they did before as externally there have not been any changes, but the extra fan opposite of the exhaust fan will increase the air flow through the machine and cool the samples quicker. | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Line 235: | Line 237: | ||
'''Background on Disease Markers'''<br> | '''Background on Disease Markers'''<br> | ||
Parkinson’s Disease is a degenerative disorder in the nervous system where the nerve cells cannot send messages to the muscles adequately due to a lack of dopamine. This usually leads to tremors and a difficulty moving. Typically, Parkinson’s disease develops in person after the age of 50, but it is not always the case. This disease cannot be cured, but it can be treated. | Parkinson’s Disease is a degenerative disorder in the nervous system where the nerve cells cannot send messages to the muscles adequately due to a lack of dopamine. This usually leads to tremors and a difficulty moving. Typically, Parkinson’s disease develops in person after the age of 50, but it is not always the case. This disease cannot be cured, but it can be treated. | ||
<br> | |||
This disease is generally contracted through genetics. The SNP of this is can be found in SNP cluster report of rs2853826. The error is due to an adenine nucleotide replaced with the guanine.<br><br> | This disease is generally contracted through genetics. The SNP of this is can be found in SNP cluster report of rs2853826. The error is due to an adenine nucleotide replaced with the guanine.<br><br> | ||
Source:[[ http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=2853826]] | Source:[[ http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=2853826]] | ||
Line 248: | Line 251: | ||
The forward primer used: TGGTTAAGCCCTCAGTCTAAT | The forward primer used: TGGTTAAGCCCTCAGTCTAAT | ||
In the case of Parkinson's Disease, the nucleotide adenine, usually denoted by A, has been replaced by the nucleotide guanine, usually denoted by G, as shown in the DNA sequence above. However, the primer only binds to the matching opposite sequence. That is, A only pairs with T, or thymine, and G only pairs with C, or cytosine. Thus, this creates a situation in which the primer is unable to bind to the DNA strand. Since the primer cannot bind to the DNA sequence beyond the point of the nucleotide substitution, the double helix is left disentangled and the reaction cannot occur. This leads to unsuccessful amplification, which means that the results would appear to be negative as they will not be visible. | |||
<br><br> | |||
If the Parkinson's gene is present, then the matching opposite primer will successfully bind to the DNA strand. This will then be visible as a positive result, because of the fact that the attached primer would aid in proceeding the amplification process. | |||
Latest revision as of 13:58, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features Instructions
ProtocolsPolymerase Chain Reaction
PCR Protocol
The time for this experiment will be reduced due to the improvements made on the PCR machine. It should cycle much quicker than it did before (about an hour and a half to two hours). How much of a time difference is uncertain.
The Components of the GoTaq® Colorless Master Mix
Volumes Used for Mixture
DNA Samples (8)
DNA Measurement Protocol
Open ImageJ Research and DevelopmentBackground on Disease Markers Parkinson’s Disease is a degenerative disorder in the nervous system where the nerve cells cannot send messages to the muscles adequately due to a lack of dopamine. This usually leads to tremors and a difficulty moving. Typically, Parkinson’s disease develops in person after the age of 50, but it is not always the case. This disease cannot be cured, but it can be treated.
The reverse primer used: ATTAGACTGA-G-GGCTTAACCA The forward primer used: TGGTTAAGCCCTCAGTCTAAT
|